(r11) Barrick Lab :: MEGAWHOP

---+ Megaprimer whole plasmid cloning
 aka <nop>MEGAWHOP cloning %BR% aka Overlap Extension PCR cloning

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. _Biotechniques_.48(6):463-5.

---++ Purpose

To insert a DNA sequence into a plasmid without restriction enzymes. 

---++ Experimental Steps

   * Create primers that amplify region of interest and hybridize with target plasmid
   * Perform a Phusion PCR with primers using the region of interest as template
   * Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
   * Digest Second PCR with Dpn1 to remove parental plasmid
   * Transform in _E coli_

<img width="763" alt="genome_mod_figure.JPG" src="%ATTACHURLPATH%/genome_mod_figure.JPG" height="146" />

---++ Designing Primers
 <img width="374" alt="primers.png" src="%ATTACHURLPATH%/primers.png" height="204" />

Primers need to have two components
   * a region that amplifies the insert (A(or B), 20-25nt)
   * a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

---++ PCR Insert
 Use standard 25ul Phusion (or other high fidelity polymerase) protocol 
   * PCR 1(25ul reaction)
   * 5 ul 5x Buffer
   * 1.5 ul dntps
   * 1.25 ul primer (A+C)
   * 1.25 ul primer (B+D)
   * x ul template plasmid (&lt;250ng)
   * ddH20 to 24.5 ul
   * then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

---++ PCR Recombinant Plasmid
 Use modified 10ul Phusion (or other high fidelity polymerase) protocol 
   * 2 ul 5x Buffer
   * 1 ul dntps
   * 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
   * ~10 ng target plasmid
   * ddH20 to 9.5 ul
   * then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

OR

Use modified 25ul Phusion protocol
   * 5 ul 5x Buffer
   * 0.5 ul dntps
   * 1 ul DMSO
   * 100 ng PCR insert product
   * 25 ng target plasmid
   * ddH20 to 25 ul
   * then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

---++ Digest
 Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. [[ProtocolsDpnIDigestion][DpnI Digest]] 
---++ Transform
 Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent _E coli_.

---++ Example
 Change the promoter for sgRNA using MegaWHOP.

Template sequence: https://benchling.com/s/g4S95i24

Primers:
   * T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
   * T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer: <br /> <img width="277" alt="MEGA_primer.png" src="%ATTACHURLPATH%/MEGA_primer.png" height="241.5" />

*PCR Recombinant Plasmid: <br /> <img width="222" alt="Recombinant_Plasmid.png" src="%ATTACHURLPATH%/Recombinant_Plasmid.png" height="235.2" />
Barrick Lab > ProtocolList > MEGAWHOP
Contributors to this topic
JeffreyBarrick, PengGeng, SeanLeonard, SteveSowa, GabrielSuarez, BrianRenda
Topic revision: r11 - 2017-12-14 - 21:12:13 - Main.PengGeng