Approach 1:

Approach 2:

Introduction

Required Materials

Procedure

These steps have worked:

• Denature at 98 deg for 1 min.
• 30 cycles of:
  • 98 deg for 30 sec
  • 62 deg for 30 sec
  • 72 deg for 15 sec
• 72 deg for 5 min

3. Confirm your PCR was successful with a DNA agarose gel and gel purify your 200-400bp product. Elute with a small volume (20 uL).
4. Use this purified megaprimer product and your template plasmid in a 2nd PCR (2x 50 uL reactions). Your control in this reaction is a reaction without your megaprimer from the previous step. Use commercial Phusion for this reaction (or other super high fidelity polymerase). Each tube should contain very little template plasmid (1 uL or 50 ng) and 5 uL of your purified megaprimer product. Concentrations for the rest of your PCR reagents are standard.
These steps have worked:

• Denature at 98 deg for 2 min
• 30 cycles of:
  • 98 deg for 1 min
  • 62 deg for 30 sec
  • 72 deg for 3 min (based on a plasmid size of 5kb, you should adjust accordingly)
• 72 deg for 5 min

• x ul template plasmid (<250ng)

Example

Template sequence: https://benchling.com/s/g4S95i24

Primers:

• T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
• T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer:

*PCR Recombinant Plasmid:

Use modified 25ul Phusion protocol

• 5 ul 5x Buffer
• 0.5 ul dntps
• 1 ul DMSO
• 100 ng PCR insert product
• 25 ng target plasmid
• ddH20 to 25 ul
• then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

• 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).

Megaprimer whole plasmid cloning

MEGAWHOP

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

Experimental Steps

• Create primers that amplify region of interest and hybridize with target plasmid
• Perform a Phusion PCR with primers using the region of interest as template
• Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
• Digest Second PCR with Dpn1 to remove parental plasmid
• Transform in E coli

Designing Primers

Primers need to have two components

• a region that amplifies the insert (A(or B), 20-25nt)
• a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

• PCR 1(25ul reaction)
• 5 ul 5x Buffer
• 1.5 ul dntps
• 1.25 ul primer (A+C)
• 1.25 ul primer (B+D)
• x ul template plasmid (<250ng)
• ddH20 to 24.5 ul
• then add 0.5 ul Phusion

Set elongation time according to size of insert

Purify PCR products

PCR Recombinant Plasmid

• 2 ul 5x Buffer
• 1 ul dntps
• 500 ng PCR insert product
• ~10 ng target plasmid
• ddH20 to 9.5 ul
• then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid

Digest

Transform

-- Main.SteveSowa - 25 Apr 2012