Golden Gate: Making A New Part

Supplies

Phusion® High-Fidelity DNA Polymerase (NEB: M0530L)

10X T4 DNA ligase buffer (NEB: M0202S)

T-7 DNA ligase (NEB: M0318S)

restriction endonuclease BsaI (NEB: R0535) or BsmBI (NEB: R0580S)

competent cells

SOC and liquid media

LB plates

Protocol

Designing Primers

Primers need to have two components:

• a region that contain BsmB1 cut site and Bsa1 cut site (A(or B), 20-25nt)

• a region that amplifies the Part (C(or D)18-20nt) Order (A+C) primer and (B+D) primer.

Primer-F GCATCGTCTCATCGGTCTCA+4bp TYPE 2/3/4 over overhang (A) + 20bp amplifies the Part (C)

Primer-R ATGCCGTCTCAGGTCTCA+4bp TYPE 2/3/4 over overhang (B) + 20bp amplifies the Part(D)

Please check benchling file for detail https://benchling.com/s/ZpP63YWV/edit

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol

PCR (25ul reaction)

5 ul 5x Buffer

1.5 ul dntps

1.25 ul primer (A+C)

1.25 ul primer (B+D)

x ul template plasmid (<250ng)

ddH20 to 24.5 ul

then add 0.25 ul Phusion

Set elongation time according to size of insert. Purify PCR products

Golden Gate Assembly

1. Mix 10 fmol(backbone) and 20 fmol(each insert) of your DNA segments together.

2. Add that 2μL of 10X T4 DNA ligase buffer, 1 μL of BsaI or BsmBI, 1 μL of T7 DNA ligase , and add water up to 20 μL, mix well by pipetting.

3. Incubate the reaction at (42°C for 5 min and then 16°C for 5 min) *30 , followed by 10 min at 55°C.

4. Use 2 µl assembly reaction for electroporation.

-- Main.PengGeng - 15 Mar 2016

-- Main.PengGeng - 11 Apr 2016

Edit | Attach | Watch | Print version | History: r18 | r4 < r3 < r2 < r1 | Backlinks | Raw View | More topic actions...

 Barrick Lab  >  ProtocolList  >  ProtocolsGoldenGateMakingANewPart

Contributors to this topic Edit topic KateElston, JeffreyBarrick, DennisMishler, PengGeng, GabrielSuarez, SeanLeonard
Topic revision: r1 - 2016-04-11 - 20:22:25 - Main.PengGeng
 
This site is powered by the TWiki collaboration platform Powered by Perl This site is powered by the TWiki collaboration platformCopyright ©2025 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback