Golden Gate: Making A New Part

Supplies

10X T4 DNA ligase buffer (NEB: M0202S)

T-7 DNA ligase (NEB: M0318S)

restriction endonuclease BsaI (NEB: R0535) or BsmBI (NEB: R0580S)

competent cells

SOC and liquid media

LB plates

Protocol

Designing Primers

Primers need to have two components:

• a region that contain BsmB1 cut site and Bsa1 cut site (A(or B), 20-25nt)

• a region that amplifies the Part (C(or D)18-20nt) Order (A+C) primer and (B+D) primer.

Primer-F GCATCGTCTCATCGGTCTCA+4bp TYPE 2/3/4 over overhang (A) + 20bp amplifies the Part (C)

Primer-R ATGCCGTCTCAGGTCTCA+4bp TYPE 2/3/4 over overhang (B) + 20bp amplifies the Part(D)

Please check benchling file for detail https://benchling.com/s/ZpP63YWV/edit

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol

PCR (25ul reaction)

5 ul 5x Buffer

1.5 ul dntps

1.25 ul primer (A+C)

1.25 ul primer (B+D)

x ul template plasmid (<250ng)

ddH20 to 24.5 ul

then add 0.25 ul Phusion

Set elongation time according to size of insert. Purify PCR products

Golden Gate Assembly

1. Mix 17.7ng pYTK-001 plasmid and 20 fmol=[(0.02*(660)*(1/(10^6))*insert length)*1000]ng insert of your DNA fragments together.

2. Add that 2μL of 10X T4 DNA ligase buffer, 1 μL of BsmBI, 1 μL of T7 DNA ligase , and add water up to 20 μL, mix well by pipetting.

3. Incubate the reaction at (42°C for 5 min and then 16°C for 5 min) *30 , followed by 10 min at 55°C, 10min at 80 °C .

4. Use 2 µl assembly reaction for electroporation.

Contributors

• Peng Geng
• Jeffrey Barrick