(r4) Barrick Lab :: ProtocolsGoldenGateMakingANewPart

<noautolink>
---+ Golden Gate: Making A New Part

This protocol describes how to clone a new Golden Gate part into the YTK001 entry vector using a BsmBI assembly reaction.
 
---++ Supplies

   * Phusion® High-Fidelity DNA Polymerase (NEB: M0530L)
   * 10X T4 DNA ligase buffer (NEB: M0202S)
   * T7 DNA ligase (NEB: M0318S)
   * restriction endonuclease BsaI (NEB: R0535) or BsmBI (NEB: R0580S)
   * competent cells
   * SOC and liquid media
   * LB plates

---++ Step 1: Creating DNA for cloning


---+++ Method 1: Ordering a gBlock containing required flanking regions


---+++ Method 2: Amplifying a sequence to add required flanking regions

You need to order two primers that each consist of two pieces:
   1 (A or B) Outer region that contains a BsmBI cut site (used for cloning at this step) and BsaI cut site (that is maintained in the entry vector after cloning) (A or B) 20-25nt
   2 (C or D) Inner region that that amplifies the part sequence.

Order (A+C) primer and (B+D) primer.

Primer-F
GCATCGTCTCATCGGTCTCA+4bp TYPE 2/3/4 over overhang (A) + 20bp amplifies the Part (C)

Primer-R
ATGCCGTCTCAGGTCTCA+4bp TYPE 2/3/4 over overhang (B) + 20bp amplifies the Part(D)

Please check benchling file for detail 
https://benchling.com/s/ZpP63YWV/edit

---+++ Part Overlap Quick Reference Table

---++ Example

PCR Insert

Use standard 25ul Phusion (or other high fidelity polymerase) protocol

PCR (25ul reaction)

5 ul 5x Buffer

1.5 ul dntps

1.25 ul primer (A+C)

1.25 ul primer (B+D)

x ul template plasmid (<250ng)

ddH20 to 24.5 ul

then add 0.25 ul Phusion

Set elongation time according to size of insert. 
Purify PCR products

---++ Step 2: Golden Gate Assembly Reaction

Golden Gate Assembly

1. Mix 17.7ng pYTK-001 plasmid  and 20 fmol=[(0.02*(660)*(1/(10^6))*insert length)*1000]ng insert of your DNA fragments together.

2. Add that 2&#956;L of 10X T4 DNA ligase buffer, 1 &#956;L of BsmBI, 1 &#956;L of T7 DNA ligase , and add water up to 20 &#956;L, mix well by pipetting.

3. Incubate the reaction at (42°C for 5 min and then 16°C for 5 min) *30 , followed by 10 min at 55°C, 10min at 80 °C .

4. Use 2 µl assembly reaction for electroporation.


---++ *Contributors*

   * Peng Geng
   * Jeffrey Barrick

Barrick Lab > ProtocolList > ProtocolsGoldenGateMakingANewPart

Contributors to this topic

KateElston, JeffreyBarrick, DennisMishler, PengGeng, SeanLeonard, GabrielSuarez

Topic revision: r4 - 2016-05-10 - 20:33:52 - Main.JeffreyBarrick