| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| JC JC | REL606 | 4,415,710 | IS150 (–) +3 bp | 94.5% | coding (848‑850/1413 nt) | cycA → | D‑alanine/D‑serine/glycine transporter |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 3893554 = | NA (NA) | 94 (0.990) | 55/80 | NT | 93.5% | noncoding (1/1443 nt) | IS150 | repeat region |
| ? | REL606 | 4415710 = | 6 (0.070) | coding (848/1413 nt) | cycA | D‑alanine/D‑serine/glycine transporter | |||||
| * | ? | REL606 | = 3894996 | NA (NA) | 111 (1.200) | 53/78 | NT | 94.5% | noncoding (1443/1443 nt) | IS150 | repeat region |
| ? | REL606 | = 4415712 | 6 (0.070) | coding (850/1413 nt) | cycA | D‑alanine/D‑serine/glycine transporter | |||||
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |