Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
MC JC | REL606 | 3,894,997 | Δ6,138 bp | IS150‑mediated | rbsD–[yieO] | rbsD, rbsA, rbsC, rbsB, rbsK, rbsR, [yieO] |
Missing coverage evidence... | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | REL606 | 3893587–3894993 | 3901134 | 6142–7548 | 33 [30] | [0] 152 | insJ‑5–[yieO] | insJ‑5,insK‑5,rbsD,rbsA,rbsC,rbsB,rbsK,rbsR,[yieO] |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | REL606 | = 3894996 | NA (NA) | 148 (1.900) | 69/98 | 0.0 | 100% | noncoding (1443/1443 nt) | IS150 | repeat region |
? | REL606 | 3901135 = | 0 (0.000) | coding (1285/1428 nt) | yieO | predicted multidrug or homocysteine efflux system |
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |