Protocol for harvesting pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at 20C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters (Store at 20C frozen to keep DTT from going bad)

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day 1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37C.
Day 2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day 1: Induce
  • Use 500 L of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 m filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at 20C.

Assay purified phusion polymerase activity by PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 11971207. «PubMedCentral»

Topic attachments
I Attachment Action Size Date Who Comment
elsegbk 6his-pfu-sso7d-pET28.gbk manage 10.6 K 14 May 2015 - 16:38 Main.JeffreyBarrick  
pngpng Barrick_Lab_2016-03-08_phu_2kb-03-01.png manage 342.8 K 10 Mar 2016 - 17:05 Main.SimonDAlton  
Edit | Attach | Print version | History: r18 | r16 < r15 < r14 < r13 | Backlinks | Raw View | Raw edit | More topic actions...

 Barrick Lab  >  ProtocolList  >  ProtocolsReagentRecipes  >  ProtocolsReagentsPfuSso7d

Topic revision: r14 - 14 Mar 2016 - 16:29:06 - Main.JeffreyBarrick
 
This site is powered by the TWiki collaboration platformCopyright ©2017 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback