Predicted mutation | |||||||
---|---|---|---|---|---|---|---|
evidence | seq id | position | mutation | freq | annotation | gene | description |
JC JC | REL606 | 3,841,192 | IS150 (+) +3 bp | 100% | coding (389‑391/1074 nt) | recF ← | recombination protein F |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | REL606 | 3841192 = | 0 (0.000) | 115 (1.210) | 58/80 | NT | 100% | coding (391/1074 nt) | recF | recombination protein F |
? | REL606 | = 3894996 | NA (NA) | noncoding (1443/1443 nt) | IS150 | repeat region | |||||
* | ? | REL606 | = 3841194 | 0 (0.000) | 119 (1.320) | 60/76 | NT | 100% | coding (389/1074 nt) | recF | recombination protein F |
? | REL606 | 3893554 = | NA (NA) | noncoding (1/1443 nt) | IS150 | repeat region |
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |