| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| JC JC | REL606 | 4,092,861 | IS150 (+) +3 bp | 100% | coding (87‑89/429 nt) | yiiT → | stress‑induced protein |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 3893554 = | NA (NA) | 96 (1.070) | 55/76 | NT | 100% | noncoding (1/1443 nt) | IS150 | repeat region |
| ? | REL606 | = 4092863 | 0 (0.000) | coding (89/429 nt) | yiiT | stress‑induced protein | |||||
| * | ? | REL606 | = 3894996 | NA (NA) | 90 (1.030) | 53/74 | NT | 100% | noncoding (1443/1443 nt) | IS150 | repeat region |
| ? | REL606 | 4092861 = | 0 (0.000) | coding (87/429 nt) | yiiT | stress‑induced protein | |||||
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |