| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| JC JC | REL606 | 3,841,192 | IS150 (+) +3 bp | coding (389‑391/1074 nt) | recF ← | recombination protein F |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 3841192 = | 0 (0.000) | 81 (1.020) | 60/100 | 0.1 | 100% | coding (391/1074 nt) | recF | recombination protein F |
| ? | REL606 | = 3894996 | NA (NA) | noncoding (1443/1443 nt) | IS150 | repeat region | |||||
| * | ? | REL606 | = 3841194 | 0 (0.000) | 128 (1.680) | 64/96 | 0.0 | 100% | coding (389/1074 nt) | recF | recombination protein F |
| ? | REL606 | 3893554 = | NA (NA) | noncoding (1/1443 nt) | IS150 | repeat region | |||||
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |