| |
| META TOPICPARENT |
name="ProtocolList" |
Megaprimer whole plasmid cloning |
|
<
< | aka MEGAWHOP cloning
aka Overlap Extension PCR cloning |
>
> | aka MEGAWHOP cloning
aka Overlap Extension PCR cloning |
| |
Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.
Purpose |
|
<
< | To insert a DNA sequence into a plasmid without restriction enzymes. |
| | |
|
>
> | To insert a DNA sequence into a plasmid without restriction enzymes. |
| | Experimental Steps
- Create primers that amplify region of interest and hybridize with target plasmid
- Perform a Phusion PCR with primers using the region of interest as template
- Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
- Digest Second PCR with Dpn1 to remove parental plasmid
- Transform in E coli
Designing Primers
Primers need to have two components
- a region that amplifies the insert (A(or B), 20-25nt)
- a region that targets the new plasmid (C(or D), 30-40nt)
The target plasmid regions should preferably be 50-200nt apart (C to D).
Order (A+C) primer and (B+D) primer.
PCR Insert |
|
<
< | Use standard 25ul Phusion (or other high fidelity polymerase) protocol |
>
> | Use standard 25ul Phusion (or other high fidelity polymerase) protocol |
| |
- PCR 1(25ul reaction)
- 5 ul 5x Buffer
- 1.5 ul dntps
- 1.25 ul primer (A+C)
- 1.25 ul primer (B+D)
- x ul template plasmid (<250ng)
- ddH20 to 24.5 ul
- then add 0.5 ul Phusion
Set elongation time according to size of insert.
Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.
PCR Recombinant Plasmid |
|
<
< | Use modified 10ul Phusion (or other high fidelity polymerase) protocol |
>
> | Use modified 10ul Phusion (or other high fidelity polymerase) protocol |
| |
- 2 ul 5x Buffer
- 1 ul dntps
- 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
- ~10 ng target plasmid
- ddH20 to 9.5 ul
- then add 0.5 ul Phusion
Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).
OR
Use modified 25ul Phusion protocol
- 5 ul 5x Buffer
- 0.5 ul dntps
- 1 ul DMSO
- 100 ng PCR insert product
- 25 ng target plasmid
- ddH20 to 25 ul
- then add 0.25 ul Phusion
68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).
Digest |
|
<
< | Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest |
>
> | Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest |
| | Transform |
|
<
< | Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli. |
>
> | Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli. |
| |
Example |
|
<
< | Change the promoter for sgRNA using MegaWHOP. |
>
> | Change the promoter for sgRNA using MegaWHOP. |
| |
Template sequence: https://benchling.com/s/g4S95i24
Primers:
- T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
- T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'
UPCASE LETTERS: a region that amplifies the insert (A(or B)
lower case letters: a region that targets the new plasmid (C(or D)
*PCR MEGA_primer:
*PCR Recombinant Plasmid:
| META FILEATTACHMENT |
attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1" |
| META FILEATTACHMENT |
attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1" |
| META FILEATTACHMENT |
attachment="MEGA_primer.png" attr="h" comment="" date="1481836218" name="MEGA_primer.png" path="MEGA_primer.png" size="71929" stream="MEGA_primer.png" tmpFilename="/usr/tmp/CGItemp40125" user="PengGeng" version="1" |
| META FILEATTACHMENT |
attachment="Recombinant_Plasmid.png" attr="h" comment="" date="1481836534" name="Recombinant_Plasmid.png" path="Recombinant_Plasmid.png" size="87615" stream="Recombinant_Plasmid.png" tmpFilename="/usr/tmp/CGItemp40185" user="PengGeng" version="1" |
|
