Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
JC JC | REL606 | 3,981,782 | IS150 (–) +3 bp | coding (249‑251/1224 nt) | ECB_03710 ← | putative permease |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | REL606 | 3893554 = | NA (NA) | 78 (0.980) | 49/100 | 0.4 | 100% | noncoding (1/1443 nt) | IS150 | repeat region |
? | REL606 | 3981782 = | 0 (0.000) | coding (251/1224 nt) | ECB_03710 | putative permease | |||||
* | ? | REL606 | = 3894996 | NA (NA) | 120 (1.540) | 60/98 | 0.0 | 100% | noncoding (1443/1443 nt) | IS150 | repeat region |
? | REL606 | = 3981784 | 0 (0.000) | coding (249/1224 nt) | ECB_03710 | putative permease |
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |