<noautolink> ---++ Protocol for harvesting _pfu-sso7d_ (aka Phusion) polymerase This protocol is for expressing and purifying the high fidelity _pfu-sso7d_ polymerase [1] from _E. coli_. This protein is sold as Phusion polymerase by [[http://www.neb.com][New England Biolabs]]. This _pfu_ variant has the _sso7d_ processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using _taq_. See the [[https://www.neb.com/products/m0530-phusion-high-fidelity-dna-polymerase][NEB website]] for a description of other key enzyme characteristics. Expression plasmid sequence: [[%ATTACHURL%/6his-pfu-sso7d-pET28.gbk][6his-pfu-sso7d-pET28.gbk]] ---+++ Materials needed: * Glycerol stock of EQ458 _E. coli_ cells<br> The strain used is named EQ458. It is located in common species box; this is a [[http://www.emdmillipore.com/life-science-research/rosetta-2de3-competent-cells/EMD_BIO-71397/p_brGb.s1OagkAAAEjQxl9.zLX][Rosetta 2 (DE3) E. coli strain]] containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony. * LB medium. [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsRecipesLuriaBertani][Link to LB recipe]] * Chloramphenicol stock. [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAntibioticStockSolutions][Link to Cam recipe]] * Kanamycin stock. [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAntibioticStockSolutions][Link to Kan recipe]] * Refrigerated centrifuge. * Spectrophotometer and cuvettes. * French press. Georgiou lab, MBB, 3.310, ask before using. * IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at 20°C. * Disposable plastic columns. [[http://www.piercenet.com/product/disposable-plastic-columns][ThermoSci, cat #29922]] * Ni-NTA agarose resin. [[http://www.qiagen.com/products/catalog/sample-technologies/protein-sample-technologies/purification-kits-and-resins/ni-nta-agarose][Qiagen, cat #30210, 25 ml]] * Slide-A-Lyzer, 10k dialysis cassette G2. [[http://www.piercenet.com/product/slide-a-lyzer-g2-dialysis-cassettes-10k-mwco][ThermoSci, cat# 87730]] Lysis Buffer: * 50 mM NaH<sub>2</sub>PO<sub>4</sub> * 300 mM NaCl * 10mM Imidazole * Adjust pH to 8.0 using NaOH Wash Buffer: * 50 mM NaH<sub>2</sub>PO<sub>4</sub> * 300 mM NaCl * 40mM Imidazole * Adjust pH to 8.0 using NaOH Elution Buffer: * 50 mM NaH<sub>2</sub>PO<sub>4</sub> * 300 mM NaCl * 250 mM Imidazole * Adjust pH to 8.0 using NaOH Polymerase storage buffer: Make 3-4 Liters (Store at 20°C frozen to keep DTT from going bad) * 50% Glycerol * 100 mM Tris/HCl pH 8.0 * 0.2 mM EDTA * 2 mM DTT * 0.2% NP-40; nonionic detergent * 0.2% Tween20 ---+++ Protein Expression Scaled for 2 x 500 mL cultures *Day 1: Revive and Isolate Colony* * Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C. *Day 2: Precondition* * Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm. *Day 1: Induce* * Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. * Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm. *Day 0: Harvest* * Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins. * Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette. * French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure. * Collect and reintroduce into french press 1x. * Heat denature at 70°C for about 15 mins. * Spin down, 10,000 x g for 30 mins. * Syringe filter the supernatant (0.22 µm filter). * Proceed to IMAC purifications. ---++++ Immobilized metal ion affinity chromatography (IMAC) purification Note: Save portions at each step for protein gel * Prepare a 1 mL Ni-NTA resin column. * Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice. * Bind with 1:1 lysis buffer:SN sample. * Wash with 1x column volume of lysis buffer. * Wash with 5x (column volume) of wash buffer. * Elute with 3 mL of elution buffer and collect all 3 mL of elution. ---+++ Dialysis: * Place dialysis cassette into storage buffer for 2 mins. * Remove top and load dialysis cassette with enzyme sample using a pipette or syringe. * Squeeze the membrane to remove excess air. * Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate. * Allow to sit for 2 to 4 hours. * Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight. * If cassette has swollen, use syringe to remove some of the sample. * Open top of cassette and remove sample. * Store at 20°C. ---+++ Assay purified phusion polymerase activity by PCR * IMPORTANT: You must use commercial Phusion buffer ([[https://www.neb.com/products/b0518-phusion-hf-buffer-pack][NEB Cat #B0518S]]) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance. * Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase. * To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock. * NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy. Primer sequences (position with reference to sequence in file above): | *Name* | *Position* | *Tm* | *5' - 3'* | *Amplicon size w/ R1 (bp)* | | Phusion F1 | 672-695 | 66.4 | agttccataggatggcaagatcc | 4044 | | Phusion F2 | 2748-2770 | 66.5 | tgataccgatgaaacgagagagg | 1968 | | Phusion F3 | 3759-3779 | 66.4 | gagctgtcttcggtatcgtcg | 957 | | Phusion F4 | 4169-4190 | 66.7 | aacattagtgcaggcagcttcc | 547 | | Phusion R1 | 4694-4716 | 67.8 | cctaatgcaggagtcgcataagg | NA | Protocol: | *Reagent* | *Volume/ul* | | Water | 12.4 | | dNTP (10mM) | 0.4 | | 5x buffer | 4 | | Primer F (10uM) | 1 | | Primer R (10uM) | 1 | | Template (2ng/ul) | 1 | | Diluted Phusion | 0.2 | Conditions (Denaturation-Annealing-Extension repeated 30x): | *Cycle* | *Temperature* | *Duration (secs)* | | Initial denaturation | 98 | 30s | | Denaturation | 98 | 10s | | Annealing | 69 | 20s | | Extension | 72 | 30s / kbp | | Final extension | 72 | 5m | Sample results for 2kbp amplicon: | Lane | 1 | 2 | 3 | 4 | 5 | | Phusion dilution | 25 | 50 | 100 | NEB (neat) | H20 | <div style="float: left;"> <img src="%ATTACHURLPATH%/Barrick_Lab_2016-03-08_phu_2kb-03-01.png" alt="Phusion 2kb.jpg" width='250' /> </div> ---+++ References 1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. _Nucleic Acids Res._ *32*: 11971207. [[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC373405/][«PubMedCentral»]]
Attachments
Attachments
Topic attachments
I
Attachment
History
Action
Size
Date
Who
Comment
gbk
6his-pfu-sso7d-pET28.gbk
r1
manage
10.6 K
2015-05-14 - 16:38
JeffreyBarrick
png
Barrick_Lab_2016-03-08_phu_2kb-03-01.png
r1
manage
342.8 K
2016-03-10 - 17:05
SimonDAlton
This topic: Lab
>
WebHome
>
ProtocolList
>
ProtocolsReagentRecipes
>
ProtocolsReagentsPfuSso7d
Topic revision: r14 - 2016-03-14 - JeffreyBarrick
Copyright © 2008-2025 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki?
Send feedback