Barrick Lab :: ProtocolsReagentsPfuSso7d

<noautolink>
---++ Protocol for harvesting _pfu-sso7d_ (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity _pfu-sso7d_ polymerase [1] from _E. coli_. This protein is sold as Phusion polymerase by [[http://www.neb.com][New England Biolabs]]. This _pfu_ variant has the _sso7d_ processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using _taq_.

See the [[https://www.neb.com/products/m0530-phusion-high-fidelity-dna-polymerase][NEB website]] for a description of other key enzyme characteristics.

Expression plasmid sequence: [[%ATTACHURL%/6his-pfu-sso7d-pET28.gbk][6his-pfu-sso7d-pET28.gbk]]

---+++ Materials needed:
   
   * Glycerol stock of EQ458 _E. coli_ cells<br> The strain used is named EQ458.  It is located in common species box; this is a [[http://www.emdmillipore.com/life-science-research/rosetta-2de3-competent-cells/EMD_BIO-71397/p_brGb.s1OagkAAAEjQxl9.zLX][Rosetta 2 (DE3) E. coli strain]] containing 6his-pfu-sso7d-pET28 plasmid.  The plasmid is KanR and the strain itself is CamR.  The frozen stock is overnight growth of a single colony.
   * LB medium.  [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsRecipesLuriaBertani][Link to LB recipe]]
   * Chloramphenicol stock.  [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAntibioticStockSolutions][Link to Cam recipe]]
   * Kanamycin stock.  [[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAntibioticStockSolutions][Link to Kan recipe]]
   * Refrigerated centrifuge.
   * Spectrophotometer and cuvettes.
   * French press. Georgiou lab, MBB, 3.310, ask before using.
   * IPTG, 100 mM stock.  Dissolve 2.38 g IPTG in 100 mL deionized water.  Filter sterilize and store at –20°C.
   * Disposable plastic columns. [[http://www.piercenet.com/product/disposable-plastic-columns][ThermoSci, cat #29922]]
   * Ni-NTA agarose resin. [[http://www.qiagen.com/products/catalog/sample-technologies/protein-sample-technologies/purification-kits-and-resins/ni-nta-agarose][Qiagen, cat #30210, 25 ml]]
   * Slide-A-Lyzer, 10k dialysis cassette G2. [[http://www.piercenet.com/product/slide-a-lyzer-g2-dialysis-cassettes-10k-mwco][ThermoSci, cat# 87730]]

Lysis Buffer:
   * 50 mM NaH<sub>2</sub>PO<sub>4</sub>
   * 300 mM NaCl
   * 10mM Imidazole
   * Adjust pH to 8.0 using NaOH

Wash Buffer:
   * 50 mM NaH<sub>2</sub>PO<sub>4</sub>
   * 300 mM NaCl
   * 40mM Imidazole
   * Adjust pH to 8.0 using NaOH

Elution Buffer:
   * 50 mM NaH<sub>2</sub>PO<sub>4</sub>
   * 300 mM NaCl
   * 250 mM Imidazole
   * Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters %BR%
   * 50% Glycerol
   * 100 mM Tris/HCl pH 8.0
   * 0.2 mM EDTA
   * 0.2% NP-40; nonionic detergent
   * 0.2% Tween20
   * 2 mM DTT (add immediately before use)
*IMPORTANT*: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.

---+++ Protein Expression

Scaled for 2 x 500 mL cultures

*Day –1: Revive and Isolate Colony*
   * Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458.  Growth plate overnight at 37°C.
*Day –2: Precondition*
   * Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
*Day –1: Induce*
   * Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
   * Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
*Day 0: Harvest*
   * Collect cells by centrifugation.  Conditions as follows:  4°C, at 10,000 x g for 15 mins.
   * Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
   * French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
   * Collect and reintroduce into french press 1x.
   * Heat denature at 70°C for about 15 mins.
   * Spin down, 10,000 x g for 30 mins.
   * Syringe filter the supernatant (0.22 µm filter).
   * Proceed to IMAC purifications.

---++++ Immobilized metal ion affinity chromatography (IMAC) purification
Note: Save portions at each step for protein gel
   * Prepare a 1 mL Ni-NTA resin column.
   * Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
   * Bind with 1:1 lysis buffer:SN sample.
   * Wash with 1x column volume of lysis buffer. 
   * Wash with 5x (column volume) of wash buffer.
   * Elute with 3 mL of elution buffer and collect all 3 mL of elution.

---+++ Dialysis:
   * Place dialysis cassette into storage buffer for 2 mins.
   * Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
   * Squeeze the membrane to remove excess air. 
   * Replace top and place in beaker with 500 mL or 1 L of storage buffer.  This should be done in the cold room on a stir plate.
   * Allow to sit for 2 to 4 hours.
   * Remove cassette and place in beaker with fresh storage buffer.  Allow to sit overnight.
   * If cassette has swollen, use syringe to remove some of the sample. 
   * Open top of cassette and remove sample.
   * Store at –20°C.

---+++ Assay purified phusion polymerase activity by PCR
  * IMPORTANT: You must use commercial Phusion buffer ([[https://www.neb.com/products/b0518-phusion-hf-buffer-pack][NEB Cat #B0518S]]) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
   * Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
   * To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
   * NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

| *Name* | *Position* | *Tm* | *5' - 3'* | *Amplicon size w/ R1 (bp)* |
| Phusion F1 | 672-695 | 66.4 | agttccataggatggcaagatcc | 4044 |
| Phusion F2 | 2748-2770 | 66.5 | tgataccgatgaaacgagagagg | 1968 |
| Phusion F3 | 3759-3779 | 66.4 | gagctgtcttcggtatcgtcg | 957 |
| Phusion F4 | 4169-4190 | 66.7 | aacattagtgcaggcagcttcc | 547 |
| Phusion R1 | 4694-4716 | 67.8 | cctaatgcaggagtcgcataagg | NA |

Protocol:

| *Reagent* | *Volume/ul* |
| Water | 12.4 |
| dNTP (10mM) | 0.4 |
| 5x buffer | 4 |
| Primer F (10uM) | 1 |
| Primer R (10uM) | 1 |
| Template (2ng/ul) | 1 |
| Diluted Phusion | 0.2 |

Conditions (Denaturation-Annealing-Extension repeated 30x):

| *Cycle* | *Temperature* | *Duration (secs)* | 
| Initial denaturation | 98 | 30s |
| Denaturation | 98 | 10s |
| Annealing | 69 | 20s |
| Extension | 72 | 30s / kbp |
| Final extension | 72 | 5m |

Sample results for 2kbp amplicon:

| Lane | 1 | 2 | 3 | 4 | 5 |
| Phusion dilution | 25 | 50 | 100 | NEB (neat) | H20 |

<div style="float: left;">
<img src="%ATTACHURLPATH%/Barrick_Lab_2016-03-08_phu_2kb-03-01.png" alt="Phusion 2kb.jpg" width='250' />
</div>


---+++ References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. _Nucleic Acids Res._ *32*: 1197–1207. [[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC373405/][&laquo;PubMedCentral&raquo;]]
Attachments
Topic attachments
I	Attachment	History	Action	Size	Date	Who	Comment
gbk	6his-pfu-sso7d-pET28.gbk	r1	manage	10.6 K	2015-05-14 - 16:38	JeffreyBarrick
png	Barrick_Lab_2016-03-08_phu_2kb-03-01.png	r1	manage	342.8 K	2016-03-10 - 17:05	SimonDAlton
This topic: Lab > WebHome > ProtocolList > ProtocolsReagentRecipes > ProtocolsReagentsPfuSso7d
Topic revision: r15 - 2016-04-27 - JeffreyBarrick