Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use standard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

OR

Use modified 25ul Phusion protocol

  • 5 ul 5x Buffer
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion

68C 5min+98C 3min+(98C 30s+68C 30s+72C X min)*30 +72C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37C for one and a half hours to remove parental DNA. DpnI Digest

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

Example

Change the promoter for sgRNA using MegaWHOP.

Template sequence: https://benchling.com/s/g4S95i24

Primers:

  • T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer:
MEGA_primer.png

*PCR Recombinant Plasmid:
Recombinant_Plasmid.png

 Barrick Lab  >  ProtocolList  >  MEGAWHOP

Topic revision: r10 - 13 Jun 2017 - 16:26:42 - Main.GabrielSuarez
 
This site is powered by the TWiki collaboration platformCopyright ©2017 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback