New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? 79 = 1078060 (0.900)27 (0.410) 16/200 3.4 47.4% intergenic (–/–) –/– –/–
?93 = 17731 0 (0.000)intergenic (–/–) –/– –/–
Rejected: Coverage evenness skew score above cutoff.

GTCGGTCACCCGTAGGCCTGATAAGACACGTTAAACGTCACATCAGGCATCGCTTGTCGGATGCGGCGCTAGCGCCTTATCCGACCTACATTGGTGGTCCC‑‑‑‑‑‑‑‑‑  >  93/17631‑17731
                                                                                                    |         
tggtggtccccgtagacctgataagacacgttaacCGTCACATCAGGCATCGCTTGTCGGATGCGGCGCTAGCGCCTTATCCGACCTACATTGGTGGTccc           <  1:925901‑M1/66‑1 (MQ=255)
    ggtccccgtagacctgataagacacgttaacCGTCACATCAAGGAGCGCATATCGGATGGGGAGCTAGTGCCTTATCCGACCTACATTGGtggtcccgtag       <  2:1521646‑M1/70‑5 (MQ=255)
     gtccccgtagacctgataagacacgttaacCGTCACATCAGGCATCGCTTGTCGGATGCGGCGCTAGCGCCTTATCCGACCTACATTGgtggtcccgtagg      <  2:1025812‑M1/71‑6 (MQ=255)
         ccGTAGACCTGATAAGACACGTTAACCGTCACATCAGGCATCGCTTGTCGGATGCGGCGCTAGCGCCTTATCCGACCTACATTGGTGGTcccgtaggcctg  <  2:1405432/101‑10 (MQ=37)
                                                                                                    |         
GTCGGTCACCCGTAGGCCTGATAAGACACGTTAAACGTCACATCAGGCATCGCTTGTCGGATGCGGCGCTAGCGCCTTATCCGACCTACATTGGTGGTCCC‑‑‑‑‑‑‑‑‑  >  93/17631‑17731

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 20 ≤ ATCG/ATCG < 29 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.