Golden Gate: Making A New Part
This protocol describes how to clone a new Golden Gate part into the YTK001 entry vector using a BsmBI assembly reaction.
Supplies
- Phusion® High-Fidelity DNA Polymerase (NEB: M0530L)
- 10X T4 DNA ligase buffer (NEB: M0202S)
- T7 DNA ligase (NEB: M0318S)
- restriction endonuclease BsaI (NEB: R0535) or BsmBI (NEB: R0580S)
- competent cells
- SOC and liquid media
- LB plates
Step 1: Creating DNA for cloning
Method 1: Ordering a gBlock containing required flanking regions
Method 2: Amplifying a sequence to add required flanking regions
You need to order two primers that each consist of two pieces:
- (A or B) Outer region that contains a BsmBI cut site (used for cloning at this step) and BsaI cut site (that is maintained in the entry vector after cloning) (A or B) 20-25nt
- (C or D) Inner region that that amplifies the part sequence.
Order (A+C) primer and (B+D) primer.
Primer-F
GCATCGTCTCATCGGTCTCA+4bp TYPE 2/3/4 over overhang (A) + 20bp amplifies the Part (C)
Primer-R
ATGCCGTCTCAGGTCTCA+4bp TYPE 2/3/4 over overhang (B) + 20bp amplifies the Part(D)
Please check benchling file for detail
https://benchling.com/s/ZpP63YWV/edit
Part Overlap Quick Reference Table
Example
PCR Insert
Use standard 25ul Phusion (or other high fidelity polymerase) protocol
PCR (25ul reaction)
5 ul 5x Buffer
1.5 ul dntps
1.25 ul primer (A+C)
1.25 ul primer (B+D)
x ul template plasmid (<250ng)
ddH20 to 24.5 ul
then add 0.25 ul Phusion
Set elongation time according to size of insert.
Purify PCR products
Step 2: Golden Gate Assembly Reaction
Golden Gate Assembly
1. Mix 17.7ng pYTK-001 plasmid and 20 fmol=[(0.02*(660)*(1/(10^6))*insert length)*1000]ng insert of your DNA fragments together.
2. Add that 2μL of 10X T4 DNA ligase buffer, 1 μL of BsmBI, 1 μL of T7 DNA ligase , and add water up to 20 μL, mix well by pipetting.
3. Incubate the reaction at (42°C for 5 min and then 16°C for 5 min) *30 , followed by 10 min at 55°C, 10min at 80 °C .
4. Use 2 µl assembly reaction for electroporation.
Contributors
- Peng Geng
- Jeffrey Barrick