<noautolink> ---+ *Golden Gate: Making A New Part* ---++ *Supplies* Phusion® High-Fidelity DNA Polymerase (NEB: M0530L) 10X T4 DNA ligase buffer (NEB: M0202S) T-7 DNA ligase (NEB: M0318S) restriction endonuclease BsaI (NEB: R0535) or BsmBI (NEB: R0580S) competent cells SOC and liquid media LB plates ---++ *Protocol* Designing Primers Primers need to have two components: • a region that contain BsmB1 cut site and Bsa1 cut site (A(or B), 20-25nt) • a region that amplifies the Part (C(or D)18-20nt) Order (A+C) primer and (B+D) primer. Primer-F GCATCGTCTCATCGGTCTCA+4bp TYPE 2/3/4 over overhang (A) + 20bp amplifies the Part (C) Primer-R ATGCCGTCTCAGGTCTCA+4bp TYPE 2/3/4 over overhang (B) + 20bp amplifies the Part(D) Please check benchling file for detail https://benchling.com/s/ZpP63YWV/edit PCR Insert Use stardard 25ul Phusion (or other high fidelity polymerase) protocol PCR (25ul reaction) 5 ul 5x Buffer 1.5 ul dntps 1.25 ul primer (A+C) 1.25 ul primer (B+D) x ul template plasmid (<250ng) ddH20 to 24.5 ul then add 0.25 ul Phusion Set elongation time according to size of insert. Purify PCR products Golden Gate Assembly 1. Mix 17.7ng pYTK-001 plasmid and 20 fmol=[(0.02*(660)*(1/(10^6))*insert length)*1000]ng insert of your DNA fragments together. 2. Add that 2μL of 10X T4 DNA ligase buffer, 1 μL of BsmBI, 1 μL of T7 DNA ligase , and add water up to 20 μL, mix well by pipetting. 3. Incubate the reaction at (42°C for 5 min and then 16°C for 5 min) *30 , followed by 10 min at 55°C, 10min at 80 °C . 4. Use 2 µl assembly reaction for electroporation. ---++ *Contributors* * Peng Geng * Jeffrey Barrick
This topic: Lab
>
WebHome
>
ProtocolList
>
ProtocolsGoldenGateMakingANewPart
Topic revision: r3 - 2016-05-10 - JeffreyBarrick