Difference: ProcedureGenomeModificationDatsenkoWanner (1 vs. 11)

Lambda Red Protocol

Lambda Red Plasmids

These plasmids are available as part of the Wanner Lambda Red disruption kit from the E. coli Genetic Stock Center.

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200 ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
  • The 1ml recovery solution can directly be placed at 30°C shaker for 1.5 hrs (without adding it to 10ml as indicated)
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
  • Can (and possibly should) store at 4°C overnight rather than on bench.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

Expected Results

The data below used 20 ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30 µL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55°C annealing temperature, 25 cycles). Gel purify the 900 bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

This method can also be used to edit plasmids in-vivo, especially when the plasmid is large and difficult to modify through other methods. The procedure is identical to the method used for chromosomal recombination. 50-100ng of purified PCR product was used to recombine with a medium copy 40kb plasmid successfully (10-15 copies). Recommended to plate the whole 1ml recovery mixture (spin it down, discard 900ul and resuspend the pellet in 100ul of media). Plate on selective media. Note that at this point cells will contain a mixture of both modified and unmodified plasmid. Grow colonies in selective liquid media and miniprep the cultures. This miniprep will also likely contain a mixture of plasmids. However, transforming the plasmid mixture and plating on selective plates should yield colonies that only contain the modified plasmid.

References

1. Datsenko, K.A., Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
   Original paper describing method.
2. Mori, H., Baba, T., Yokoyama, K., Takeuchi, R., Nomura, W., Makishi, K., Otsuka, Y., Dose, H., Wanner, B. L. (2015) Identification of essential genes and synthetic lethal gene combinations in Escherichia coli K-12. Methods Mol. Biol. 1279: 45–65.
   Detailed protocol describing the construction of the Keio collection via the Datsenko & Wanner method.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike

Lambda Red Protocol

Lambda Red Plasmids

These plasmids are available as part of the Wanner Lambda Red disruption kit from the E. coli Genetic Stock Center.

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200 ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.

• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
  • Can (and possibly should) store at 4°C overnight rather than on bench.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

NOTE Recover at 30°C if you intend on maintaining pKD46. This plasmid's origin is temperature sensitive and does not function properly at 37°C.

Expected Results

The data below used 20 ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30 µL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55°C annealing temperature, 25 cycles). Gel purify the 900 bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

1. Datsenko, K.A., Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.
   Original paper describing method.
2. Mori, H., Baba, T., Yokoyama, K., Takeuchi, R., Nomura, W., Makishi, K., Otsuka, Y., Dose, H., Wanner, B. L. (2015) Identification of essential genes and synthetic lethal gene combinations in Escherichia coli K-12. Methods Mol. Biol. 1279: 45–65.
   Detailed protocol describing the construction of the Keio collection via the Datsenko & Wanner method.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike

Lambda Red Protocol

Lambda Red Plasmids

These plasmids are available as part of the Wanner Lambda Red disruption kit from the E. coli Genetic Stock Center.

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
  • Can (and possibly should) store at 4°C overnight rather than on bench.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

Expected Results

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike

Lambda Red Protocol

Lambda Red Plasmids

These plasmids are available as part of the Wanner Lambda Red disruption kit from the E. coli Genetic Stock Center.

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.

• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

NOTE Recover at 30°C if you intend on maintaining pKD46. Plasmid's origin does not function properly at 37°C.

Expected Results

The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles). Gel purify the 900bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike

Lambda Red Protocol

Lambda Red Plasmids

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

NOTE Recover at 30°C if you intend on maintaining pKD46. Plasmid's origin does not function properly at 37°C.

Expected Results

The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles). Gel purify the 900bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike

Lambda Red Protocol

Lambda Red Plasmids

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.

• Spin @ 3000 x g for 5 minutes, resuspend in cold water.

• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

NOTE Recover at 30°C if you intend on maintaining pKD46. Plasmid's origin does not function properly at 37°C.

Expected Results

The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles). Gel purify the 900bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012

Lambda Red Protocol

Lambda Red Plasmids

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).

• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

Expected Results

BW25113

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)

Lambda Red Protocol

Lambda Red Plasmids

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette

• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)

Lambda Red Protocol

Making Competent Cells expressing Lambda Red

Day 1

Day 2

Transforming Cells

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)

Lambda Red Protocol

Lambda Red Plasmid

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46) in 2mL LB-Amp overnight at 30°C

Day 2

• Dilute 1:80, 500 uL -> 40mL SOB-Amp. (LB can also be used, but SOB is preferred)
• Grow on 30 deg shaker until OD600 = ~ 0.350 - 0.400, should take 2-3 hours
• Induce cultures with filtered 10% Arabinose creating a final concentration of 0.1% Arabinose
• Place back on 30°C shaker for 15 minutes
• After induction, immediately transfer culture to 50mL falcon tube and place on ice for 40 min
• Spin cultures 3000rpm x 15 min to pellet cells.
• Resuspend pellet in 35 mL cold ddH20
• Spin 5000 rpm for 10 minutes
• Wash again with 30 mL ddH20 or 10% Glycerol if making frozen stocks Spin 7000rpm for 10 minutes. Dump out water, shake off H20 gently, careful not to disturb pellet. Return tubes to ice bucket. Allow time for residual liquid in tube to collect on pellet. Swirl to resuspend pellet.
• Aliquot 50 uL cell suspension into cold eppendorf tubes. 1 for each electroporation

NOTE 40 mL culture should produce approximately 250-350 uL of cells, enough for 5-7 50 uL electroporations. Dilute cells with ddH20/10% glycerol if needed.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt) Transfer cells + DNA to cold 1mm (or 2mm) gap cuvettes
• Electroporate, recover immediately with 1mL SOC (draw SOC into pipette tip before electroporating)
• Transfer to culture tube, place on 37°C shaker for 1.5 hrs
• Plate 100-200 uL of recovery onto selection plate. Leave recovery culture on bench O/N, plate more next day if unsuccessful
• Grow selection plate 37°C overnight; Colonies may a full 24 hours to appear

NOTE Recover at 30 deg if you intend on maintaining pKD46. Plasmid is usually lost at 37°C

Lambda Red Protocol

Adopted from Datsenko and Wanner, 2000, edited by Steven Sowa.

Lambda Red Plasmid

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46) in 2mL LB-Amp overnight at 30°C

Day 2

• Dilute 1:80, 500 uL -> 40mL SOB-Amp. (LB can also be used, but SOB is preferred)
• Grow on 30 deg shaker until OD600 = ~ 0.350 - 0.400, should take 2-3 hours
• Induce cultures with filtered 10% Arabinose creating a final concentration of 0.1% Arabinose
• Place back on 30°C shaker for 15 minutes
• After induction, immediately transfer culture to 50mL falcon tube and place on ice for 40 min
• Spin cultures 3000rpm x 15 min to pellet cells.
• Resuspend pellet in 35 mL cold ddH20
• Spin 5000 rpm for 10 minutes
• Wash again with 30 mL ddH20 or 10% Glycerol if making frozen stocks Spin 7000rpm for 10 minutes. Dump out water, shake off H20 gently, careful not to disturb pellet. Return tubes to ice bucket. Allow time for residual liquid in tube to collect on pellet. Swirl to resuspend pellet.
• Aliquot 50 uL cell suspension into cold eppendorf tubes. 1 for each electroporation

NOTE 40 mL culture should produce approximately 250-350 uL of cells, enough for 5-7 50 uL electroporations. Dilute cells with ddH20/10% glycerol if needed.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt) Transfer cells + DNA to cold 1mm (or 2mm) gap cuvettes
• Electroporate, recover immediately with 1mL SOC (draw SOC into pipette tip before electroporating)
• Transfer to culture tube, place on 37°C shaker for 1.5 hrs
• Plate 100-200 uL of recovery onto selection plate. Leave recovery culture on bench O/N, plate more next day if unsuccessful
• Grow selection plate 37°C overnight; Colonies may a full 24 hours to appear

NOTE Recover at 30 deg if you intend on maintaining pKD46. Plasmid is usually lost at 37°C

-- Main.SteveSowa - 04 Apr 2012