---+ _Acinetobacter baylyi ADP1_ Golden Transformation ---++ Overview The following protocol is to be used as a substitute for overlap extension PCR for constructing double-stranded DNA fragments that template sequence replacements and/or deletions in the ADP1 genome. Addition of the flanking sequence homology needed for efficient transformation is based on Golden Gate Assembly and is much simpler and less time consuming to perform. Fundamentally, [[http://www.ncbi.nlm.nih.gov/pubmed/25871405][Golden Gate Assembly/cloning]] involves the use of plasmids which contain defined parts, called “part plasmids”, that when cut with BsaI enzymes and re-ligated (using the Golden Gate Reaction reagents and thermocycler protocol), allows the assembly of multiple parts in the desired order into a new plasmid. All this is achieved in a single reaction tube, and then the unpurified reaction mix can be used to transform competent cells. Here we use Golden Gate assembly to simply add flanking homology to the pos/neg selection cassette (tdk/kan) we routinely use for ADP1 transformations. Thus, this reaction requires only three DNA parts: <br/> A- pYTK001-tdkkan-camR plasmid <br/> B- Purified PCR product of 5’-flank homology (~1kb) <br/> C- Purified PCR product of 3’-flank homology (~1kb) <br/> <br/> * The 3 reaction components <br /> <img src="%ATTACHURLPATH%/Figure_GoldenGateTransformation.JPG" alt="Figure_GoldenGateTransformation.JPG" width='200' height='250' /> <br/> Note: pYTK001-tdkkan-camR plasmid (ColE1 origin) doesn't replicate on ADP1, thus can be used as an additional negative control during transformations. ---++ Primer design The [[http://openwetware.org/wiki/User:Gabriel_A._Suarez/Notebook/ADP1_Baylyi_reference][tdk/kan cassette]] in the pYTK001 plasmid has *BsaI* sites at both ends of its sequence such that when cut by a BsaI enzyme – which cuts outside its recognition sequence - will leave the standard 4bp Golden Gate *type2/type4* sticky ends. In this procedure, a *BsaI* site is added to each flanking homology which is designed to provide the complementary *type2* and *type4* sticky ends, thereby allowing the correct assembly of the three parts as follows: * Transformation cassette generated by the Golden Extension reaction <br /> <img src="%ATTACHURLPATH%/Image_Type2Type4.JPG" alt="Image_Type2Type4.JPG" width='478.4' height='56.8' /> Each of the target’s flanks needs to be amplified in independent PCR reactions, so only two sets of primers are required. *Primer Set 1*: 5’FW + GoldenRV5’ [5-ATGCGGTCTCACGTTCGTCTCAGACC (N)<sub>20</sub> -3’] </br> N = ~20bp Reverse complement terminal sequence of 5'flanking homology *Primer Set 2*: GoldenFW3’ [5-GCATGGTCTCAGCTGCGTCTCAGGTC (N)<sub>20</sub> -3’] + 3’Rv </br> N = ~20bp Fw terminal sequence of 3'flanking homology Each set contains one *“Golden Primer”* (GoldenFW3’ or GoldenRV5’) which contains ~20bp (denoted as a sequence of Ns) overlapping/targeting the flank to be amplified, plus BsaI and BsmBI sites. BsmBI sites will be used for construction of “rescue” cassette used to remove tdk/kan at the final stage of this protocol. See figure below for details. <img src="%ATTACHURLPATH%/Figure_rescue.JPG" alt="Figure_rescue.JPG" width=718.3' height='226.05' /> The annealing temperatures for the “Golden Primer” are determined by the sequence of N’s chosen (the overlapping sequence). It is critical that the primers on each set have about the same annealing temperature (aim 60C for Phusion pol). The Barrick Lab routinely uses the NEB Tm Calculator (http://tmcalculator.neb.com/#!/) to determine primer annealing temperatures and IDT’s OligoAnalyzer Tool (https://www.idtdna.com/calc/analyzer) to check for hairpins or self-dimers, thus avoiding most common problems in primer design. %X% Additional BsaI or BsmBI sites on the 3'-flank or 5'-flank chosen should not be a problem (so far has never been observed to be an issue), since these would generate unique sticky ends which would re-ligate during the Golden Extension Reaction. If you want to be extra careful, you can select flanks with fewer or non of these present in them. ---++Golden Extension Reaction 1. Use *set1* and *set2* primers to run PCR reactions to amplify both flanking regions of the target deletion/replacement site. <br/> 2. Run a gel electrophoresis to verify that the correct PCR product size was amplified. <br/> 3. Purify the PCR products using PCR purification columns and measure the DNA concentrations. <br/> 4. In a PCR tube, setup the BsaI Golden Extension Reaction with the following: <br/> - Reaction components - <br/> 2 μL of 10X T4 DNA ligase buffer (NEB: M0202S) <br/> 1 μL BsaI (NEB: R3535S) <br/> 1 μL of T7 DNA ligase (NEB: M0318S)** <br/> 250ng pYTK001-tdkkan-CamR plasmid <br/> 150 ng 5’flank homology (for ~1000bp)* <br/> 150 ng 3’flank homology (for ~1000bp)* <br/> dH2O to 20µL rxn total volume <br/> *Depending on the length of each flank homology, fragment (flanks) to plasmid ratio can be adjusted to achieve the optimal 1:1:1 for each part, considering that the tdk/kan cassette is only 1.7kb and about half the size of the pYTK001-tdkkan-CamR plasmid (3.3kb). The [[http://www.promega.com/a/apps/biomath/index.html?calc=ugpmols][Promega ug to pmol calculator]] is useful for balancing out quantities. <br/> For more Golden Gate rxn details, see the [[ProtocolsGoldenGateAssembly][Golden Gate Assembly Protocol]] <br/> **T4 ligase may be used instead, but T7 ligase is preferred because it rarely generates any blunt ligation products and thus yields minimal off-target ligation. T7 ligase buffer is avoided because it contains PEG which is known to inhibit electroporation, although its effects on natural competence are unknown. 5. Run thermocycler with the following setting: <br/> 1) 37°C, 5:00 <br/> 2) 16°C, 5:00 <br/> 3) Goto 1, 30X <br/> 4) 55°C, 5:00 <br/> 5) 80°C, 5:00 <br/> 6) 12°C, ∞ <br/> *Note:* You can use a shorter 1:00 incubation for each 37°C/16°C temperature step in the cycle, but yield and number of colonies may decrease. *Transformation steps:* <br/> 6. Prepare two tubes with 500 µL LB media + 35 µL overnight culture. Label one “NoDNA control” and the other “DNA+”. <br/> 7. Add all 20 µL of the Golden Gate rxn to the tube labeled “DNA+”. <br/> 8. Incubate overnight (or at least 6hrs) at 30C, 200 rpm. <br/> 9. Plate 100 µL of the transformation mix into an LB-Kan plate and incubate overnight. Plate also 100µL of the “NoDNA” negative control on another LB-Kan plate. <br/> 10. Select 2-3 colonies to grow in liquid LB-Kan and proceed to confirm deletion/replacement in each by PCR. <br/> <br/> Note: This procedure is yet to be tested using different size flanking homologies and varying amounts of DNA, two critical factors that affect transformation efficiencies. Under the specified conditions, the transformation efficiency observed is roughly 1.25 x 10<sup>–5</sup>, thus plating 100 µL will yield ~1000 colonies (ADP1-ISx strain) and why it's recomended to also plate 100x dilutions to make it easier to later pick out single colonies. It may be possible to obtain a good amount of transformants using lower DNA concentrations, which would be useful if you have lower quantities of any of the parts previous to the assembly or if you need to do multiple transformations with the 20 µL Golden Gate rxn product (e.g., use only 10 µL per transformation mix). ---++Tdk/kan cassette “rescue” (Removal of tdk/kan marker with minimal 4bp scar) 1. Ligate 3’-flank to 5’-flank (using same PCR products step#3 above) by BsmBI Golden Gate assembly. <br/> <br/> - Reaction components - <br/> 2 μL of 10X T4 DNA ligase buffer (NEB: M0202S) <br/> 1 μL BsmBI (NEB: R0580S) <br/> 1 μL of T7 DNA ligase (NEB: M0318S) <br/> 100 ng 5’flank homology <br/> 100 ng 3’flank homology <br/> dH2O to 20µL rxn total volume <br/> Tips and general Golden Gate Assembly protocol: http://barricklab.org/twiki/bin/view/Lab/ProtocolsGoldenGateAssembly) 2. Run thermocycler with the following setting (or as described before with shorter one-minute incubation times). <br/> 1) 37°C, 5:00 <br/> 2) 16°C, 5:00 <br/> 3) Goto 1, 30X <br/> 4) 55°C, 5:00 <br/> 5) 80°C, 5:00 <br/> 6) 12°C, ∞ <br/> 3. Repeat transformation steps above, but this time plate on LB-AZT (include a 100X dilution to make sure you can pick out single colony isolates). Once colonies are visible, select 3-5 to grow in liquid LB and confirm tdk/kan removal by PCR using the 5'-flank FW primer with the 3'-flank RV primer (e.g., a 2kb band will be your positive result). Successful confirmation can be additionally be supported by testing their no-growth on LB-kan (negative control). ---++Tdk/kan cassette “rescue” and replacement (Replacement of tdk/kan marker with minimal 4bp scar) In order to replace tdk/kan with another gene of interest, you will first need to create a cassette with 5’-flank homology, a functioning promoter/RBS sequence, your gene of interest, and 3' flank homology. Creating this cassette from scratch may involve troubleshooting for a working promoter/RBS. More directly, you can design your primers to retain the tdk promoter/RBS and to replace the tdk gene, the kan promoter/RBS, and the kan gene with your gene of interest. This process mirrors the Primer Design section above, but your 5' flank will be designed to overlap the tdk promoter sequence:<br/> 5' - CCCAGCCTCCAATTCAAATCATAAAAAATTTATTTGCTTTATTAAAGAGGAGAAATTAATTA - 3' Specifically, your 5' flank golden reverse primer will target the end of the tdk promoter, using the following *BsaI recognition site and cut site (NNNN)* and a length of _flanking homology_ that gives you an appropriate annealing temperature (~60°C)<br/> _e.g._ 5' - ATGC *GGTCTCANNNN* _TAATTAATTTCTCCTCTTTAATAAAGCA_ - 3' <br/> Your final cassette will have 5’-flank homology, the tdk promoter/RBS (62bp), your gene of interest, and 3' flank homology. ---+++ Contributors Gabriel Suarez<br/> Julie Perreau
This topic: Lab
>
WebHome
>
ProtocolList
>
ProtocolsAcinetobacterGoldenTransformation
Topic revision: r16 - 2016-12-21 - JuliePerreau