| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| MC JC | REL606 | 3,894,997 | Δ6,138 bp | 100% | IS150‑mediated | rbsD–[yieO] | rbsD, rbsA, rbsC, rbsB, rbsK, rbsR, [yieO] |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | REL606 | 3893584–3894993 | 3901134 | 6142–7551 | 56 [51] | [0] 227 | insJ‑5–[yieO] | insJ‑5,insK‑5,rbsD,rbsA,rbsC,rbsB,rbsK,rbsR,[yieO] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | = 3894996 | NA (NA) | 133 (1.440) | 64/78 | NT | 100% | noncoding (1443/1443 nt) | IS150 | repeat region |
| ? | REL606 | 3901135 = | 0 (0.000) | coding (1285/1428 nt) | yieO | predicted multidrug or homocysteine efflux system | |||||
GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 | gACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAc < 1:1768627/51‑1 (MQ=35) | GACCTATATGCCTCGTGTTTAACTGTCCAACTTTTTGGGGTCAGTACAGAC > REL606/3894949‑3894999 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |