ProtocolsBroccoliAptamerInVitroAssays < Lab

---+ Measuring transcription _in vitro_ Using Broccoli and Spinach Fluorescent RNA Aptamers:

---+++ Background / Usage:

Broccoli and Spinach are two versions of an RNA aptamer tag that fluoresces with similar spectral properties to GFP when properly folded. Both require a small-molecule fluorophore (DFHBI); the Barrick lab has a stock of fluorophore, and it can be purchased from a number of vendors (as of 5/2017). These aptamers can be used for a variety of applications; this protocol covers using them to measure transcriptional output from T7 RNA Polymerase / promoter mutants _in vitro_, but they can also be used to measure transcription <em>in vivo </em>in bacteria or eukaryotic cells or (by using the aptamer as a fusion tag) to determine subcellular localization of RNA transcripts.

For _in vitro_ experiments, we have had most success using linear templates ~120bp. These can be produced either by subjecting overlapping oligos to an extension reaction, or by using shorter primers to amplify the template from a plasmid. Note that both of these methods can be used to swap promoters if needed.

There is also a lot of good information on the Jaffrey lab web page:

[[http://www.jaffreylab.org/Pages/SpinachPlasmids.aspx][http://www.jaffreylab.org/Pages/SpinachPlasmids.aspx]]

I've had the most success using the Broccoli aptamer available from AddGene (some useful protocol info here also):

[[http://www.addgene.org/66788/][http://www.addgene.org/66788/]]

We have purchased DFHBI (the small molecule needed for fluorescence) from Tocris, although it may be available elsewhere:

[[https://www.tocris.com/products/dfhbi_5609][https://www.tocris.com/products/dfhbi_5609]]

---+++ Designing and Amplifying Templates

Depending on the specific application, there are several ways to generate a linear template. The one that has worked best for me was to PCR the aptamer region of the Broccoli plasmid (see link above), then use that PCR product as the template for a second large-scale (3-6mL) PCR using a forward primer incorporating one of several T7RP promoter variants. Primers used were:

PCR #1 (2x 50uL):<br /> Fwd: GTTGCCATGTGTATGTGGGAGACGG<br /> Rev: TTGCCATGAATGATCCCGAAGGATC

[[Excel PCR1 Template]]

PCR #2 (48-96x 50uL):<br /> Fwd: AAATTAATACGACTCACTATAGGGTTGCCATGTGTATGTGGGAGACGG (incorporates a strong T7RP promoter, bases 5-21)<br /> Rev: TTGCCATGAATGATCCCGAAGGATC (same as PCR #1)

[[Excel PCR2 Template]]

---+++ _in vitro_ Transcription Assay

[[Excel Broccoli Txn Template]]

---+++ References

   1 Paige, J. S., Wu, K. Y., & Jaffrey, S. R. (2011). RNA mimics of green fluorescent protein. _Science_, 333(6042), 642-646. [[https://www.ncbi.nlm.nih.gov/pubmed/21798953][PubMed]]
   1 Filonov, G. S., Moon, J. D., Svensen, N., & Jaffrey, S. R. (2014). Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution. _J Am Chem Soc_, 136(46), 16299-16308. [[https://www.ncbi.nlm.nih.gov/pubmed/%2025337688][PubMed]]
   1 Meyer, A. J., Ellefson, J. W., & Ellington, A. D. (2015). Directed Evolution of a Panel of Orthogonal T7 RNA Polymerase Variants for in Vivo or in Vitro Synthetic Circuitry. _ACS Synth Biol_, 4(10), 1070-1076. [[https://www.ncbi.nlm.nih.gov/pubmed/25279711][PubMed]]

-- Main.ColinBrown - 25 May 2017
Barrick Lab > ProtocolList > ProtocolsBroccoliAptamerInVitroAssays
Topic revision: r2 - 2018-03-29 - 16:41:52 - Main.ColinBrown