Barrick Lab :: ProcedureGenomeModificationDatsenkoWanner

---++ Lambda Red Protocol
 
---++ Lambda Red Plasmids

   * pKD46 (ampR)
   * pKD78 (camR)

---++ Making Competent Cells expressing Lambda Red

---+++ Day 1

   * Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

---+++ Day 2

   * Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
   * Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
   * Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
   * Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes.  Start chilling centrifuge to 4°C.
   * Spin cultures @ 1800 x g for 15 min to pellet cells.  
   * Resuspend pellet in 30 mL cold water.
      * cold 10% glycerol is also commonly used instead of water without incident.
   * Spin @ 3000 x g for 5 minutes, resuspend in cold water.
      * cold 10% glycerol is also commonly used instead of water without incident.
   * Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
   * After this spin cycle, while pouring out the glycerol pay close attention to the pellet.  It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube.  Remaining volume will likely be between 10 to 3 mL.
   * Rebalance centrifuge, spin @ 3000 x g for 5 minutes.  Pour off all glycerol, pellet should be stable.
   * Add back cold 10% glycerol for desired cell density, and number of elctroporations.  Usually 300uL will yield a good cell density for ~6 electroporations.  Resuspend pellet by pipetting with 1mL pipette.
   * Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

---++ Transforming Cells

   * Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
   * Transfer cells + DNA to a chilled gap cuvette
   * Electroporate, recover immediately with 1mL SOC/SOB/LB.
   * Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
   * Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
   * Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

*NOTE* Recover at 30°C if you intend on maintaining pKD46.  Plasmid's origin does not function properly at 37°C.

---+++ Expected Results

The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells.  To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles).  Gel purify the 900bp band.

*Primers*

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

*Strain*: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.


*REL606*
%TABLE{headeralign="left,center,center,center,center,left" dataalign="center,center,center,center"}%
| *Colonies on selective plate* | *Colonies on control plate* | *Dilution Factor* | *Recombination Efficiency* |
| 5 | 65 | 10^5 | 7.7E-8 | |
| 8 | 37 | 10^5 | 2.2E-7 | |
| 7 | 53 | 10^5 | 1.3E-7 | |

*BW25113*
%TABLE{headeralign="left,center,center,center,center,left" dataalign="center,center,center,center"}%
| *Colonies on selective plate* | *Colonies on control plate* | *Dilution Factor* | *Recombination Efficiency* |
| 1 | 135 | 10^5 | 7.4E-9 | |
| 1 | 152 | 10^5 | 6.6E-9 | |
| 3 | 125 | 10^5 | 2.4E-8 | |



---+++ References

   1 Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in _Escherichia coli_ K-12 using PCR products. _Proc. Natl. Acad. Sci. USA_ *97*, 6640-6645.

---+++ Contributors

   * Originally from Erik Quandt (6/7/2011)
   * Edited by Steven Sowa (6/2011)
   * Edited by -- Main.NeilGottel - 11 Sep 2012
   * Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike
This topic: Lab > WebHome > ProtocolList > ProcedureGenomeModificationDatsenkoWanner
Topic revision: r6 - 2013-04-03 - DanielDeatherage