Difference: ProtocolsReagentsPfuSso7d (19 vs. 20)

Revision 202018-06-07 - JeffreyBarrick

Line: 1 to 1
 
META TOPICPARENT name="ProtocolsReagentRecipes"
Changed:
<
<

Protocol for harvesting Pfu-Sso7d polymerase

>
>

Protocol for harvesting Pfu-Sso7d polymerase

  This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.

Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Changed:
<
<

Materials needed:

>
>

Materials needed

 
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
Changed:
<
<
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
>
>
  • LB medium (recipe)
  • Chloramphenicol stock (recipe)
  • Kanamycin stock (recipe])
  • Refrigerated centrifuge
  • Spectrophotometer and cuvettes
  • French press (Ex: Georgiou lab, MBB 3.310, ask before using!)
  • IPTG (100 mM) stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
 
Changed:
<
<
Lysis Buffer:
>
>
Lysis Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Wash Buffer:
>
>
Wash Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Elution Buffer:
>
>
Elution Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Polymerase storage buffer: Make 3-4 Liters
>
>
Polymerase storage buffer Make 3-4 Liters
 
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
Line: 46 to 46
 
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)
Added:
>
>
 IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
Changed:
<
<

Protein Expression

>
>

Protein Expression

 
Changed:
<
<
Scaled for 2 x 500 mL cultures
>
>
Scaled for 2×500 mL cultures
  Day –1: Revive and Isolate Colony
  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Line: 58 to 59
 
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
Changed:
<
<
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
>
>
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18°C, 250 rpm.
 Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
Line: 69 to 70
 
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.
Changed:
<
<

Immobilized metal ion affinity chromatography (IMAC) purification

>
>

Immobilized metal ion affinity chromatography (IMAC) purification

  Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
Changed:
<
<
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
>
>
  • Saturate column with 5× the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
 
  • Bind with 1:1 lysis buffer:SN sample.
Changed:
<
<
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
>
>
  • Wash with 1× column volume of lysis buffer.
  • Wash with 5× (column volume) of wash buffer.
 
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.
Changed:
<
<

Dialysis:

>
>

Dialysis:

 
  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
Line: 89 to 90
 
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.
Changed:
<
<

Assay purified phusion polymerase activity by PCR

>
>

Assay purified polymerase activity by PCR

 
  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
Changed:
<
<
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
>
>
  • The template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB Phusion or a similar polymerase.
 
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.
Changed:
<
<
Primer sequences (position with reference to sequence in file above):
>
>
Primer sequences (position with reference to sequence in file above)
 
Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Line: 105 to 106
 
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA
Changed:
<
<
Protocol:
>
>
Reaction Mix
 
Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
Changed:
<
<
5x buffer 4
>
>
5× buffer 4
 
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Changed:
<
<
Diluted Phusion 0.2
>
>
Diluted polymerase 0.2
 
Changed:
<
<
Conditions (Denaturation-Annealing-Extension repeated 30x):
>
>
* PCR Conditions* (Denaturation-Annealing-Extension repeated 30x):
 
Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Added:
>
>
Repeat Cycle 30×
 
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Added:
>
>
End Cycle
 
Final extension 72 5m
Changed:
<
<
Sample results for 2kbp amplicon:
>
>
Sample results for 2-kb amplicon
 
Lane 1 2 3 4 5
Changed:
<
<
Phusion dilution 25 50 100 NEB (neat) H20
>
>
Phusion dilution 25 50 100 NEB (neat) H2O
  Phusion 2kb.jpg
Line: 140 to 143
 

References

Changed:
<
<
1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
>
>
Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
 
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
 
This site is powered by the TWiki collaboration platform Powered by Perl This site is powered by the TWiki collaboration platformCopyright ©2021 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback