Difference: ProtocolsReagentsPfuSso7d (1 vs. 23)

Revision 232023-11-12 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"
Added:
>
>
Dear internet,
We don't distribute this plasmid. If you want to purify your own enzymes to save money, here are some options to investigate:
 

Protocol for harvesting Pfu-Sso7d polymerase

This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.

Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Materials needed

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
  • LB medium (recipe)
  • Chloramphenicol stock (recipe)
  • Kanamycin stock (recipe])
  • Refrigerated centrifuge
  • Spectrophotometer and cuvettes
  • French press (Ex: Georgiou lab, MBB 3.310, ask before using!)
  • IPTG (100 mM) stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)

Warning, important IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.

Protein Expression

Scaled for 2×500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18°C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into French press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5× the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1× column volume of lysis buffer.
  • Wash with 5× (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Warning, important NOTE: This purification protocol does not perfectly purify the polymerase from all other E. coli proteins. Expect your protein sample to still be heterogeneous if you run it on a gel. Don't worry, it will have sufficient purity for DNA amplification. The heating step at 70°C during harvesting helps precipitate many E. coli proteins.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.

Assay purified polymerase activity by PCR

  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • The template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB Phusion or a similar polymerase.
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.

Primer sequences (position with reference to sequence in file above)

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Reaction Mix

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5× buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted polymerase 0.2

* PCR Conditions* (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Repeat Cycle 30×
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
End Cycle
Final extension 72 5m

Sample results for 2-kb amplicon

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H2O

Phusion 2kb.jpg

Limitations of purified polymerase

We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.

7kb_4kb.pdf

References

  1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"

Revision 222019-05-09 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting Pfu-Sso7d polymerase

This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.

Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Materials needed

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
  • LB medium (recipe)
  • Chloramphenicol stock (recipe)
  • Kanamycin stock (recipe])
  • Refrigerated centrifuge
  • Spectrophotometer and cuvettes
  • French press (Ex: Georgiou lab, MBB 3.310, ask before using!)
  • IPTG (100 mM) stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)

Warning, important IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.

Protein Expression

Scaled for 2×500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18°C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into French press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5× the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1× column volume of lysis buffer.
  • Wash with 5× (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Warning, important NOTE: This purification protocol does not perfectly purify the polymerase from all other E. coli proteins. Expect your protein sample to still be heterogeneous if you run it on a gel. Don't worry, it will have sufficient purity for DNA amplification. The heating step at 70°C during harvesting helps precipitate many E. coli proteins.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.

Assay purified polymerase activity by PCR

  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • The template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB Phusion or a similar polymerase.
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.

Primer sequences (position with reference to sequence in file above)

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Reaction Mix

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5× buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted polymerase 0.2

* PCR Conditions* (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Repeat Cycle 30×
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
End Cycle
Final extension 72 5m

Sample results for 2-kb amplicon

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H2O

Phusion 2kb.jpg

Limitations of purified polymerase

We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.

7kb_4kb.pdf

References

Changed:
<
<
Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
>
>
  1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
 
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"

Revision 212018-06-08 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting Pfu-Sso7d polymerase

This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.

Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Materials needed

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
  • LB medium (recipe)
  • Chloramphenicol stock (recipe)
  • Kanamycin stock (recipe])
  • Refrigerated centrifuge
  • Spectrophotometer and cuvettes
  • French press (Ex: Georgiou lab, MBB 3.310, ask before using!)
  • IPTG (100 mM) stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)
Changed:
<
<
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
>
>
Warning, important IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
 

Protein Expression

Scaled for 2×500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18°C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
Changed:
<
<
  • Collect and reintroduce into french press 1x.
>
>
  • Collect and reintroduce into French press 1x.
 
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5× the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1× column volume of lysis buffer.
  • Wash with 5× (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.
Added:
>
>
Warning, important NOTE: This purification protocol does not perfectly purify the polymerase from all other E. coli proteins. Expect your protein sample to still be heterogeneous if you run it on a gel. Don't worry, it will have sufficient purity for DNA amplification. The heating step at 70°C during harvesting helps precipitate many E. coli proteins.
 

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.

Assay purified polymerase activity by PCR

  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • The template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB Phusion or a similar polymerase.
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.

Primer sequences (position with reference to sequence in file above)

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Reaction Mix

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5× buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted polymerase 0.2

* PCR Conditions* (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Repeat Cycle 30×
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
End Cycle
Final extension 72 5m

Sample results for 2-kb amplicon

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H2O

Phusion 2kb.jpg

Limitations of purified polymerase

We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.

7kb_4kb.pdf

References

Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"

Revision 202018-06-07 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"
Changed:
<
<

Protocol for harvesting Pfu-Sso7d polymerase

>
>

Protocol for harvesting Pfu-Sso7d polymerase

  This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.

Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Changed:
<
<

Materials needed:

>
>

Materials needed

 
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
Changed:
<
<
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
>
>
  • LB medium (recipe)
  • Chloramphenicol stock (recipe)
  • Kanamycin stock (recipe])
  • Refrigerated centrifuge
  • Spectrophotometer and cuvettes
  • French press (Ex: Georgiou lab, MBB 3.310, ask before using!)
  • IPTG (100 mM) stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
 
Changed:
<
<
Lysis Buffer:
>
>
Lysis Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Wash Buffer:
>
>
Wash Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Elution Buffer:
>
>
Elution Buffer
 
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Polymerase storage buffer: Make 3-4 Liters
>
>
Polymerase storage buffer Make 3-4 Liters
 
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)
Added:
>
>
 IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
Changed:
<
<

Protein Expression

>
>

Protein Expression

 
Changed:
<
<
Scaled for 2 x 500 mL cultures
>
>
Scaled for 2×500 mL cultures
  Day –1: Revive and Isolate Colony
  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
Changed:
<
<
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
>
>
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18°C, 250 rpm.
 Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.
Changed:
<
<

Immobilized metal ion affinity chromatography (IMAC) purification

>
>

Immobilized metal ion affinity chromatography (IMAC) purification

  Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
Changed:
<
<
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
>
>
  • Saturate column with 5× the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
 
  • Bind with 1:1 lysis buffer:SN sample.
Changed:
<
<
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
>
>
  • Wash with 1× column volume of lysis buffer.
  • Wash with 5× (column volume) of wash buffer.
 
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.
Changed:
<
<

Dialysis:

>
>

Dialysis:

 
  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.
Changed:
<
<

Assay purified phusion polymerase activity by PCR

>
>

Assay purified polymerase activity by PCR

 
  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
Changed:
<
<
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
>
>
  • The template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB Phusion or a similar polymerase.
 
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.
Changed:
<
<
Primer sequences (position with reference to sequence in file above):
>
>
Primer sequences (position with reference to sequence in file above)
 
Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA
Changed:
<
<
Protocol:
>
>
Reaction Mix
 
Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
Changed:
<
<
5x buffer 4
>
>
5× buffer 4
 
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Changed:
<
<
Diluted Phusion 0.2
>
>
Diluted polymerase 0.2
 
Changed:
<
<
Conditions (Denaturation-Annealing-Extension repeated 30x):
>
>
* PCR Conditions* (Denaturation-Annealing-Extension repeated 30x):
 
Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Added:
>
>
Repeat Cycle 30×
 
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Added:
>
>
End Cycle
 
Final extension 72 5m
Changed:
<
<
Sample results for 2kbp amplicon:
>
>
Sample results for 2-kb amplicon
 
Lane 1 2 3 4 5
Changed:
<
<
Phusion dilution 25 50 100 NEB (neat) H20
>
>
Phusion dilution 25 50 100 NEB (neat) H2O
  Phusion 2kb.jpg

Limitations of purified polymerase

We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.

7kb_4kb.pdf

References

Changed:
<
<
1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
>
>
Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
 
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"

Revision 192018-02-27 - SimonDAlton

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting Pfu-Sso7d polymerase

Changed:
<
<
This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.
>
>
This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.
  Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)

Materials needed:

Changed:
<
<
>
>
 
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
Changed:
<
<
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
>
>
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
 

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)
Changed:
<
<
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
>
>
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
 

Protein Expression

Scaled for 2 x 500 mL cultures

Changed:
<
<
Day –1: Revive and Isolate Colony
  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
>
>
Day –1: Revive and Isolate Colony
  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
 
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Changed:
<
<
Day –1: Induce
>
>
Day –1: Induce
 
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Changed:
<
<
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
>
>
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
 
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Changed:
<
<
Note: Save portions at each step for protein gel
>
>
Note: Save portions at each step for protein gel
 
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
Changed:
<
<
  • Wash with 1x column volume of lysis buffer.
>
>
  • Wash with 1x column volume of lysis buffer.
 
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
Changed:
<
<
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
>
>
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
 
  • Allow to sit for 2 to 4 hours.
Changed:
<
<
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
>
>
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
 
  • Open top of cassette and remove sample.
Changed:
<
<
  • Store your newly purified enzyme at –20°C.
>
>
  • Store your newly purified enzyme at –20°C.
 

Assay purified phusion polymerase activity by PCR

  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
Changed:
<
<
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main Phusion stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.
>
>
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the polymerase.
  • To estimate the activity, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified polymerase, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.
  Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Changed:
<
<
Cycle Temperature Duration (secs)
>
>
Cycle Temperature Duration (secs)
 
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20
Changed:
<
<
>
>
Phusion 2kb.jpg
Deleted:
<
<
Phusion 2kb.jpg
 

Limitations of purified polymerase

Changed:
<
<
We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.
>
>
We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.
 
Changed:
<
<
>
>
7kb_4kb.pdf
Deleted:
<
<
7kb_4kb.pdf
 

References

Changed:
<
<
1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
>
>
1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»
 
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"

Revision 182017-08-15 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"
Changed:
<
<

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

>
>

Protocol for harvesting Pfu-Sso7d polymerase

 
Changed:
<
<
This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.
>
>
This protocol is for expressing and purifying the Pfu-Sso7d polymerase from E. coli [1]. A variant of this protein with an additional 65 amino acid changes is sold as Phusion polymerase by New England Biolabs. This Pfu variant has the Sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using Taq polymerase. The reported differences in fidelity between Phusion and Pfu-Sso7d compared to Taq are 84× and 32×, respectively. See the NEB website for a description of other key polymerase characteristics.
 
Changed:
<
<
See the NEB website for a description of other key enzyme characteristics.
>
>
Download Download 6his-Pfu-Sso7d-pET28 expression plasmid sequence (GenBank format)
 
Deleted:
<
<
Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk
 

Materials needed:

Changed:
<
<
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
>
>
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-Pfu-Sso7d-pET28 plasmid. The plasmid is Kanr and the strain itself is Camr . The frozen stock is overnight growth of a single colony.
 

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before using for storage)
Changed:
<
<
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added before storing it at room temperature.
>
>
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added and was then stored at room temperature.
 

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store your newly purified enzyme at –20°C.

Assay purified phusion polymerase activity by PCR

  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.
  • After measuring the activity of your main Phusion stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg

Limitations of purified polymerase

We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.

7kb_4kb.pdf

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Changed:
<
<
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
>
>
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="h" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="h" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="h" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
Added:
>
>
META TOPICMOVED by="JeffreyBarrick" date="1502820487" from="Lab.ProtocolsReagentsPhusion" to="Lab.ProtocolsReagentsPfuSso7d"
 

Revision 172017-05-18 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
Changed:
<
<
  • 2 mM DTT (add immediately before use)
IMPORTANT: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.
>
>
  • 2 mM DTT (add immediately before using for storage)
IMPORTANT: Add fresh DTT immediately before using a batch of storage buffer to store newly purified enzyme. Your fresh DTT should be newly dissolved from powder or from a 1 M stock that you store frozen at –20°C to avoid oxidation. We have observed rapid loss of function of enzyme when enzyme is diluted in old storage buffer that had DTT added before storing it at room temperature.
 

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
Changed:
<
<
  • Store at –20°C.
>
>
  • Store your newly purified enzyme at –20°C.
 

Assay purified phusion polymerase activity by PCR

Changed:
<
<
* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
>
>
  • IMPORTANT: You probably want to use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
 
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.
Added:
>
>
  • After measuring the activity of your main Phusion stock, be sure to use storage buffer that has fresh DTT added to it for making any working dilutions of your original high concentration stock that will be stored for long periods of time at –20°C.
  Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg

Limitations of purified polymerase

Changed:
<
<
To date, we have noted reduced processitivity of longer transcripts (>4kb) using our purified polymerase compared to the commercial variant.
>
>
We have noticed reduced amplification of longer transcripts (>4kb) using our purified polymerase compared to the commercial enzyme.
 
7kb_4kb.pdf

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"

Revision 162016-07-01 - SimonDAlton

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
  • 2 mM DTT (add immediately before use)
IMPORTANT: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

Assay purified phusion polymerase activity by PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg
Added:
>
>

Limitations of purified polymerase

 
Added:
>
>
To date, we have noted reduced processitivity of longer transcripts (>4kb) using our purified polymerase compared to the commercial variant.

7kb_4kb.pdf
 

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
Added:
>
>
META FILEATTACHMENT attachment="7kb_4kb_for_wiki_crop.png" attr="" comment="" date="1467402550" name="7kb_4kb_for_wiki_crop.png" path="7kb 4kb for wiki crop.png" size="160194" stream="7kb 4kb for wiki crop.png" tmpFilename="/usr/tmp/CGItemp38781" user="SimonDAlton" version="1"
 

Revision 152016-04-27 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Polymerase storage buffer: Make 3-4 Liters (Store at –20°C frozen to keep DTT from going bad)
>
>
Polymerase storage buffer: Make 3-4 Liters
 
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
Deleted:
<
<
  • 2 mM DTT
 
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
Added:
>
>
  • 2 mM DTT (add immediately before use)
IMPORTANT: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.
 

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

Assay purified phusion polymerase activity by PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"

Revision 142016-03-14 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

Changed:
<
<
  • 50 mM NaH2PO4
>
>
  • 50 mM NaH2PO4
 
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

Changed:
<
<
  • 50 mM NaH2PO4
>
>
  • 50 mM NaH2PO4
 
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

Changed:
<
<
  • 50 mM NaH2PO4
>
>
  • 50 mM NaH2PO4
 
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Polymerase storage buffer: Make 3-4 Liters
>
>
Polymerase storage buffer: Make 3-4 Liters (Store at –20°C frozen to keep DTT from going bad)
 
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

Assay purified phusion polymerase activity by PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Phusion dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"

Revision 132016-03-10 - SimonDAlton

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

Assay purified phusion polymerase activity by PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Changed:
<
<
Sample dilution 25 50 100 NEB (neat) H20
>
>
Phusion dilution 25 50 100 NEB (neat) H20
 
Phusion 2kb.jpg

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"

Revision 122016-03-10 - SimonDAlton

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.
Changed:
<
<

PCR

>
>

Assay purified phusion polymerase activity by PCR

  * IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
Changed:
<
<
  • Perform PCRs with different dilutions of your Phusion enzyme (in storage buffer) to estimate its specific activity (units/µl).
>
>
  • Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.
Added:
>
>
  • To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.
  • NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.
 
Added:
>
>
Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)
Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044
Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968
Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957
Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547
Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul
Water 12.4
dNTP (10mM) 0.4
5x buffer 4
Primer F (10uM) 1
Primer R (10uM) 1
Template (2ng/ul) 1
Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)
Initial denaturation 98 30s
Denaturation 98 10s
Annealing 69 20s
Extension 72 30s / kbp
Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5
Sample dilution 25 50 100 NEB (neat) H20

Phusion 2kb.jpg
 

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
Added:
>
>
META FILEATTACHMENT attachment="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" attr="" comment="" date="1457629537" name="Barrick_Lab_2016-03-08_phu_2kb-03-01.png" path="Barrick Lab 2016-03-08 phu 2kb-03-01.png" size="351011" stream="Barrick Lab 2016-03-08 phu 2kb-03-01.png" tmpFilename="/usr/tmp/CGItemp37233" user="SimonDAlton" version="1"
 

Revision 112016-03-09 - SimonDAlton

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Perform PCRs with different dilutions of your Phusion enzyme (in storage buffer) to estimate its specific activity (units/µl).

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Deleted:
<
<
META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"
 
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"

Revision 102015-06-23 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk

Materials needed:

  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Perform PCRs with different dilutions of your Phusion enzyme (in storage buffer) to estimate its specific activity (units/µl).

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"

Revision 92015-05-14 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Added:
>
>
Expression plasmid sequence: 6his-pfu-sso7d-pET28.gbk
 

Materials needed:

Deleted:
<
<
 
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.

PCR

* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Perform PCRs with different dilutions of your Phusion enzyme (in storage buffer) to estimate its specific activity (units/µl).

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"
Added:
>
>
META FILEATTACHMENT attachment="6his-pfu-sso7d-pET28.gbk" attr="" comment="" date="1431621517" name="6his-pfu-sso7d-pET28.gbk" path="6his-pfu-sso7d-pET28.gbk" size="10885" stream="6his-pfu-sso7d-pET28.gbk" tmpFilename="/usr/tmp/CGItemp50005" user="JeffreyBarrick" version="1"
 

Revision 82015-01-16 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

Changed:
<
<
This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end products and typically you use higher annealing temperatures than when using taq.
>
>
This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using taq.
  See the NEB website for a description of other key enzyme characteristics.

Materials needed:

Deleted:
<
<
The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain
 
Changed:
<
<
  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette
>
>
  • Glycerol stock of EQ458 E. coli cells
    The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • French press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.
  • Disposable plastic columns. ThermoSci, cat #29922
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730
 
Changed:
<
<
Lysis Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH
>
>
Lysis Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH
 
Changed:
<
<
Wash Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH
>
>
Wash Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH
 
Changed:
<
<
Elution Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
>
>
Elution Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
 
Added:
>
>
Polymerase storage buffer: Make 3-4 Liters
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
 
Changed:
<
<
Polymerase storage buffer: Make 3-4 Liters
>
>

Protein Expression

Deleted:
<
<
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
 
Changed:
<
<

Procedure: (for 2 x 500 mL cultures)

>
>
Scaled for 2 x 500 mL cultures
 
Changed:
<
<
  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.
>
>
Day –1: Revive and Isolate Colony
  • Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.
Day –2: Precondition
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.
Day –1: Induce
  • Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Day 0: Harvest
  • Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70°C for about 15 mins.
Added:
>
>
  • Spin down, 10,000 x g for 30 mins.
  • Syringe filter the supernatant (0.22 µm filter).
  • Proceed to IMAC purifications.
 
Changed:
<
<

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.
>
>

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel
  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
Added:
>
>
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.
 
Changed:
<
<

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.
>
>

Dialysis:

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 to 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at –20°C.
 
Changed:
<
<

Validation

>
>

PCR

Added:
>
>
* IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.
  • Perform PCRs with different dilutions of your Phusion enzyme (in storage buffer) to estimate its specific activity (units/µl).
 
Deleted:
<
<
https://barricklab.org/twiki/pub/Lab/ProtocolsReagentsPfuSso7d/phusion
 

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Deleted:
<
<
  • phusion.jpg:
    phusion.jpg
 
META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"

Revision 72014-09-05 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Materials needed:

The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain

  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL cultures)

  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

https://barricklab.org/twiki/pub/Lab/ProtocolsReagentsPfuSso7d/phusion

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Added:
>
>
  • phusion.jpg:
    phusion.jpg
 
META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"

Revision 62014-06-12 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Materials needed:

The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain

  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL cultures)

  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

Changed:
<
<
phusion.jpg
>
>
https://barricklab.org/twiki/pub/Lab/ProtocolsReagentsPfuSso7d/phusion
 

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Added:
>
>
META FILEATTACHMENT attachment="phusion.jpg" attr="" comment="" date="1402583050" name="phusion.jpg" path="phusion.jpg" size="936292" stream="phusion.jpg" tmpFilename="/usr/tmp/CGItemp45399" user="CraigBarnhart" version="1"
 

Revision 52014-06-02 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end products and typically you use higher annealing temperatures than when using taq.

See the NEB website for a description of other key enzyme characteristics.

Materials needed:

The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain

  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL cultures)

  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

Added:
>
>
phusion.jpg
 

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

Revision 42014-05-14 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolsReagentRecipes"
Changed:
<
<

Protocol for harvesting phusion protein.

>
>
Added:
>
>

Protocol for harvesting _pfu-sso7d (aka Phusion) polymerase

 
Changed:
<
<

Materials needed:

>
>
This protocol is for expressing and purifying the high fidelity pfu-sso7d polymerase [1] from E. coli. This protein is sold as Phusion polymerase by New England Biolabs. This pfu variant has the sso7d processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end products and typically you use higher annealing temperatures than when using taq.
 
Added:
>
>
See the NEB website for a description of other key enzyme characteristics.

Materials needed:

 
Changed:
<
<
The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-phusion-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain
>
>
The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain
 
  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL cultures)

  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
  • Remove top and load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

Added:
>
>

References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32: 1197–1207. «PubMedCentral»

 

Revision 32014-04-14 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting phusion protein.

Materials needed:

Changed:
<
<
Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
>
>
 The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-phusion-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain
Changed:
<
<
LB medium. LB recipe
Chloramphenicol stock. Cam recipe
Kanamycin stock. Kan recipe
Refrigerated centrifuge.
Spectrophotometer and cuvettes.
FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
Disposable plastic columns. ThermoSci, cat #29922. Link to columns
Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette
>
>
  • Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
  • LB medium. Link to LB recipe
  • Chloramphenicol stock. Link to Cam recipe
  • Kanamycin stock. Link to Kan recipe
  • Refrigerated centrifuge.
  • Spectrophotometer and cuvettes.
  • FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
  • IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
  • Disposable plastic columns. ThermoSci, cat #29922. Link to columns
  • Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
Added:
>
>
  • Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette
  Lysis Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 40mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL cultures)

Changed:
<
<
  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C.
  • Select single colony from O/N streak platen and inoculate 1.5 mL of LB broth supplemented with Kan and Cam.
>
>
  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C. (Day -3)
  • Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. (Day -2)
 
  • Grow overnight at 37 C shaking at 250 rpm.
Changed:
<
<
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
>
>
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached. (Day -1)
 
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
Changed:
<
<
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins.
>
>
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins. (Day 0)
 
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
  • Spin down, 10,000 x g for 30 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.
  • Syringe filter the SN.

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

  • Place dialysis cassette into storage buffer for 2 mins.
Changed:
<
<
  • Load dialysis cassette using a pipette or syringe.
>
>
  • Remove top and load dialysis cassette using a pipette or syringe.
 
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

Revision 22014-04-14 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting phusion protein.

Materials needed:

Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-phusion-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain

LB medium. LB recipe
Chloramphenicol stock. Cam recipe
Kanamycin stock. Kan recipe
Refrigerated centrifuge.

Changed:
<
<
FRENCH laboratory press.
>
>
Spectrophotometer and cuvettes.
Added:
>
>
FRENCH laboratory press. Georgiou lab, MBB, 3.310, ask before using.
 IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
Changed:
<
<
Ni-NTA resin spin column. ThermoFisher HiPur Ni-NTA spin columns, 1ml (cat # 88225).
30k cutoff Amicon ultra-filtration membrane. Amicon Ultra-15 centrifugel filter units from Millipore (cat # UFC903008).
>
>
Disposable plastic columns. ThermoSci, cat #29922. Link to columns
Ni-NTA agarose resin. Qiagen, cat #30210, 25 ml. Link to resin
Added:
>
>
Slide-A-Lyzer, 10k dialysis cassette G2. ThermoSci, cat# 87730. Link to cassette
  Lysis Buffer:
  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
Changed:
<
<
  • 20mM Imidazole
>
>
  • 40mM Imidazole
 
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH
Changed:
<
<
Polymerase storage buffer:
>
>
Polymerase storage buffer: Make 3-4 Liters
 
  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20
Changed:
<
<

Procedure: (for 2 x 500 mL culture)

>
>

Procedure: (for 2 x 500 mL cultures)

 
Changed:
<
<
  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth overnight at 37 C.
  • Inoculate 1.5 mL of LB broth supplemented with Kan and Cam with single colony from streak plate.
  • Grow overnight at 37 C shaking at 200 rpm (????).
  • Use x uL of overnight culture to inoculate 500 mL of supplemented LB broth, grow as before for 3-4 hours until logarithmic phase is reached. Also, set up a control culture which will serve as an uninduced control.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 1.0 mM (? is this correct?) followed by overnight growth (what is total time) at 18 C.
>
>
  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth plate overnight at 37 C.
  • Select single colony from O/N streak platen and inoculate 1.5 mL of LB broth supplemented with Kan and Cam.
  • Grow overnight at 37 C shaking at 250 rpm.
  • Use 500 uL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.
 
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins.
Changed:
<
<
  • Resuspend with 3 mL of lysis buffer and place tubes in cold room bath shaker (at dial 6 ?????) for ~ 2 hours.
>
>
  • Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.
 
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
Changed:
<
<
  • Lyse cells, heat denature at 70 C for about 15 mins.
  • Spin down, 3700 - 4000 x g for 15 mins.
>
>
  • Collect and reintroduce into french press 1x.
  • Heat denature at 70 C for about 15 mins.
Added:
>
>
  • Spin down, 10,000 x g for 30 mins.
 
  • Collect and keep supernatant (SN) for IMAC purifications.
Added:
>
>
  • Syringe filter the SN.
 
Changed:
<
<

IMAC purification:

>
>

Immobilized metal ion affinity chromatography (IMAC) purification: (note: save portions at each step for protein gel).

 
  • Prepare a 1 mL Ni-NTA resin column.
Changed:
<
<
  • Saturate column with 5x lysis buffer.
>
>
  • Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.
 
  • Bind with 1:1 lysis buffer:SN sample.
Changed:
<
<
  • Wash with 5x wash buffer.
  • Elute with elution buffer and collect samples after the first 1 mL flow through.
  • Use 30k cutoff Amicon ultra-filtration membrane (???how do you use this???).
  • Top-off with storage buffer.
  • Spin at 4000 x g for 2.5 hours or so until volume is close to ~ 1 mL.
>
>
  • Wash with 1x column volume of lysis buffer.
  • Wash with 5x (column volume) of wash buffer.
  • Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis: Link to dialysis cassette use

Added:
>
>
  • Place dialysis cassette into storage buffer for 2 mins.
  • Load dialysis cassette using a pipette or syringe.
  • Squeeze the membrane to remove excess air.
  • Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.
  • Allow to sit for 2 - 4 hours.
  • Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.
  • If cassette has swollen, use syringe to remove some of the sample.
  • Open top of cassette and remove sample.
  • Store at -20 C.

Validation

 

Revision 12014-04-11 - CraigBarnhart

 
META TOPICPARENT name="ProtocolsReagentRecipes"

Protocol for harvesting phusion protein.

Materials needed:

Glycerol stock of transformed E. coli cells expressing the His-tagged protein of interest.
The strain used is named EQ458. It is located in common species box; this is a Rosetta 2 (DE3) E. coli strain containing 6his-phusion-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of single colony. link to strain

LB medium. LB recipe
Chloramphenicol stock. Cam recipe
Kanamycin stock. Kan recipe
Refrigerated centrifuge.
FRENCH laboratory press.
IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at -20 C.
Ni-NTA resin spin column. ThermoFisher HiPur Ni-NTA spin columns, 1ml (cat # 88225).
30k cutoff Amicon ultra-filtration membrane. Amicon Ultra-15 centrifugel filter units from Millipore (cat # UFC903008).

Lysis Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 10mM Imidazole
  • Adjust pH to 8.0 using NaOH

Wash Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 20mM Imidazole
  • Adjust pH to 8.0 using NaOH

Elution Buffer:

  • 50 mM NaH2PO4
  • 300 mM NaCl
  • 250 mM Imidazole
  • Adjust pH to 8.0 using NaOH

Polymerase storage buffer:

  • 50% Glycerol
  • 100 mM Tris/HCl pH 8.0
  • 0.2 mM EDTA
  • 2 mM DTT
  • 0.2% NP-40; nonionic detergent
  • 0.2% Tween20

Procedure: (for 2 x 500 mL culture)

  • Streak LB plate supplemented with Kan and Cam using frozen stock. Growth overnight at 37 C.
  • Inoculate 1.5 mL of LB broth supplemented with Kan and Cam with single colony from streak plate.
  • Grow overnight at 37 C shaking at 200 rpm (????).
  • Use x uL of overnight culture to inoculate 500 mL of supplemented LB broth, grow as before for 3-4 hours until logarithmic phase is reached. Also, set up a control culture which will serve as an uninduced control.
  • Induce the cultures to express proteins by adding IPTG at a final concentration of 1.0 mM (? is this correct?) followed by overnight growth (what is total time) at 18 C.
  • Collect cells by centrifugation. Conditions as follows: 4 C, at 10,000 x g for 15 mins.
  • Resuspend with 3 mL of lysis buffer and place tubes in cold room bath shaker (at dial 6 ?????) for ~ 2 hours.
  • French press; use the full cell holding (10 mL - 35 mL), and use 1500 psi pressure.
  • Lyse cells, heat denature at 70 C for about 15 mins.
  • Spin down, 3700 - 4000 x g for 15 mins.
  • Collect and keep supernatant (SN) for IMAC purifications.

IMAC purification:

  • Prepare a 1 mL Ni-NTA resin column.
  • Saturate column with 5x lysis buffer.
  • Bind with 1:1 lysis buffer:SN sample.
  • Wash with 5x wash buffer.
  • Elute with elution buffer and collect samples after the first 1 mL flow through.
  • Use 30k cutoff Amicon ultra-filtration membrane (???how do you use this???).
  • Top-off with storage buffer.
  • Spin at 4000 x g for 2.5 hours or so until volume is close to ~ 1 mL.
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright ©2026 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback