Difference: ProtocolsBroccoliAptamerInVitroAssays (1 vs. 2)

Revision 22018-03-29 - ColinBrown

  META TOPICPARENT 
 name="ProtocolList"
- META TOPICPARENT
+ name="ProtocolList"
-<
<
+ Measuring transcription _in vitro:
->
>
+ Measuring transcription _in vitro Using Broccoli and Spinach Fluorescent RNA Aptamers:
  Background / Usage: 

Broccoli and Spinach are two versions of an RNA aptamer tag that fluoresces with similar spectral properties to GFP when properly folded. Both require a small-molecule fluorophore (DFHBI); the Barrick lab has a stock of fluorophore, and it can be purchased from a number of vendors (as of 5/2017). These aptamers can be used for a variety of applications; this protocol covers using them to measure transcriptional output from T7 RNA Polymerase / promoter mutants in vitro, but they can also be used to measure transcription in vivo in bacteria or eukaryotic cells or (by using the aptamer as a fusion tag) to determine subcellular localization of RNA transcripts.
-<
<
+For in vitro experiments, we have had most success using linear templates ~120bp. These can be produced either by subjecting overlapping oligos to an extension reaction, or by using shorter primers to amplify the template from a plasmid. Note that both of these methods can be used to swap promoters if needed.
->
>
+For in vitro experiments, we have had most success using linear templates ~120bp. These can be produced either by subjecting overlapping oligos to an extension reaction, or by using shorter primers to amplify the template from a plasmid. Note that both of these methods can be used to swap promoters if needed.
->
>
+There is also a lot of good information on the Jaffrey lab web page:

http://www.jaffreylab.org/Pages/SpinachPlasmids.aspx

I've had the most success using the Broccoli aptamer available from AddGene (some useful protocol info here also):

http://www.addgene.org/66788/

We have purchased DFHBI (the small molecule needed for fluorescence) from Tocris, although it may be available elsewhere:

https://www.tocris.com/products/dfhbi_5609
  Designing and Amplifying Templates
-<
<
+ in vitro Transcription Assay
->
>
+Depending on the specific application, there are several ways to generate a linear template. The one that has worked best for me was to PCR the aptamer region of the Broccoli plasmid (see link above), then use that PCR product as the template for a second large-scale (3-6mL) PCR using a forward primer incorporating one of several T7RP promoter variants. Primers used were:
->
>
+PCR #1 (2x 50uL):
 Fwd: GTTGCCATGTGTATGTGGGAGACGG
 Rev: TTGCCATGAATGATCCCGAAGGATC

Excel PCR1 Template

PCR #2 (48-96x 50uL):
 Fwd: AAATTAATACGACTCACTATAGGGTTGCCATGTGTATGTGGGAGACGG (incorporates a strong T7RP promoter, bases 5-21)
 Rev: TTGCCATGAATGATCCCGAAGGATC (same as PCR #1)

Excel PCR2 Template

 in vitro Transcription Assay 

Excel Broccoli Txn Template

 References 
 

 Paige, J. S., Wu, K. Y., & Jaffrey, S. R. (2011). RNA mimics of green fluorescent protein. Science, 333(6042), 642-646. PubMed
  Filonov, G. S., Moon, J. D., Svensen, N., & Jaffrey, S. R. (2014). Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution. J Am Chem Soc, 136(46), 16299-16308. PubMed
  Meyer, A. J., Ellefson, J. W., & Ellington, A. D. (2015). Directed Evolution of a Panel of Orthogonal T7 RNA Polymerase Variants for in Vivo or in Vitro Synthetic Circuitry. ACS Synth Biol, 4(10), 1070-1076. PubMed
 -- Main.ColinBrown - 25 May 2017

Revision 12017-05-25 - ColinBrown

META TOPICPARENT	name="ProtocolList"

Measuring transcription _in vitro:

Background / Usage:

Broccoli and Spinach are two versions of an RNA aptamer tag that fluoresces with similar spectral properties to GFP when properly folded. Both require a small-molecule fluorophore (DFHBI); the Barrick lab has a stock of fluorophore, and it can be purchased from a number of vendors (as of 5/2017). These aptamers can be used for a variety of applications; this protocol covers using them to measure transcriptional output from T7 RNA Polymerase / promoter mutants in vitro, but they can also be used to measure transcription in vivo in bacteria or eukaryotic cells or (by using the aptamer as a fusion tag) to determine subcellular localization of RNA transcripts.

For in vitro experiments, we have had most success using linear templates ~120bp. These can be produced either by subjecting overlapping oligos to an extension reaction, or by using shorter primers to amplify the template from a plasmid. Note that both of these methods can be used to swap promoters if needed.

Designing and Amplifying Templates

in vitro Transcription Assay

-- Main.ColinBrown - 25 May 2017

View topic | History: r2 < r1 | More topic actions...