topA Gene Sequencing

The topA gene coordinates are 1329420-1332017.

The topA mutation in the Ara-1 long-term line is 1329516:C→T.

primer who coords sequence
RL0398 TC 1329010-1329031 5'‑CGCGGTCGATGGGTTGTGTCTC
RL0399 TC 1332121-1332101 5'‑ATCATTTATAGCCTTAGTGTA
RL0400 TC 1329557-1329577 5'‑GAGTGCCGACTCTACCTCCAC
RL0401 TC 1330088-1330109 5'‑TGCCAGCACGACCACGCCATCT
RL0402 TC 1330609-1330629 5'‑AGTTCGTTGCCTGCCAGATGA
RL0403 TC 1331103-1331122 5'‑GCTGTACTGGATCACTTCTT
RL0410, RL0610 RW, BW 1329489-1329508 5'‑GACTACGTGGTGAAATCCAG
RL0411, RL0611 RW, BW 1329683-1329663 5'‑ACCAGGCAACACTTCATAGTG
RL0738 CO 1329010-1329029 5'‑CGCGGTCGATGGGTTGTGTC
RL0739 CO 1332323-1332302 5'‑TCCCGGGTTGTGATGTGTAAAG
RL0740 CO 1329648-1329670 5'‑CACAATTGGGAGGCGCACTATGA
RL0741 CO 1331694-1331672 5'‑GTAATGGCACCGGATCTTCTTTC
RL0742 CO 1329990-1330007 5'‑GCCTGTCTGCCGGTCGTGTG
RL0743 CO 1331055-1331032* 5'‑TCTGCGCGGTAAAgTCGTAGTTCA

* This primer has a base mismatch (lowercase) to REL606. It must have been designed based on the MG1655 sequence.

All coordinates are for the reference strain REL606.

 Barrick Lab  >  ProtocolList  >  ProceduresTargetedSequencing  >  ProceduresSequencingTopA

Topic revision: r1 - 05 Aug 2009 - 14:51:18 - Main.JeffreyBarrick
 
This site is powered by the TWiki collaboration platformCopyright ©2017 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback